Alu element
This article needs to be updated.(February 2021) |
An Alu element is a short stretch of
Alu insertions have been implicated in several inherited human diseases and in various forms of cancer.
The study of Alu elements has also been important in elucidating human population genetics and the evolution of primates, including the evolution of humans.
Alu family
The Alu family is a family of repetitive elements in
There are over one million Alu elements interspersed throughout the human genome, and it is estimated that about 10.7% of the human genome consists of Alu sequences. However, less than 0.5% are
Related elements
B1 elements in rats and mice are similar to Alus in that they also evolved from 7SL RNA, but they only have one left monomer arm. 95% percent of human Alus are also found in chimpanzees, and 50% of B elements in mice are also found in rats. These elements are mostly found in introns and upstream regulatory elements of genes.[12]
The ancestral form of Alu and B1 is the fossil Alu monomer (FAM). Free-floating forms of the left and right arms exist, termed free left Alu monomers (FLAMs) and free right Alu monomers (FRAMs) respectively.[13] A notable FLAM in primates is the BC200 lncRNA.
Sequence features
Two main promoter "boxes" are found in Alu: a 5' A box with the consensus TGGCTCACGCC, and a 3' B box with the consensus GTTCGAGAC (IUPAC
Alu elements contain four or fewer
) RNA example below, functional hexamers are underlined using a solid line, with the non-functional third hexamer denoted using a dotted line:GCCGGGCGCGGTGGCGCGTGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCTGGAGGATCGCTTGAGTCCAGGAGTTCTGGGCTGTAGTGCGCTATGCCGATCGGAATAGCCACTGCACTCCAGCCTGGGCAACATAGCGAGACCCCGTCTC.
The recognition sequence of the Alu I endonuclease is 5' ag/ct 3'; that is, the enzyme cuts the DNA segment between the guanine and cytosine residues (in lowercase above).[16]
Alu elements
Alu elements are responsible for regulation of tissue-specific genes. They are also involved in the transcription of nearby genes and can sometimes change the way a gene is expressed.[17]
Alu elements are retrotransposons and look like DNA copies made from RNA polymerase III-encoded RNAs. Alu elements do not encode for protein products. They are replicated as any other DNA sequence, but depend on LINE retrotransposons for generation of new elements.[18]
Alu element replication and mobilization begins by interactions with signal recognition particles (SRPs), which aid newly translated proteins to reach their final destinations.[19] Alu RNA forms a specific RNA:protein complex with a protein heterodimer consisting of SRP9 and SRP14.[19] SRP9/14 facilitates Alu's attachment to ribosomes that capture nascent L1 proteins. Thus, an Alu element can take control of the L1 protein's reverse transcriptase, ensuring that the Alu's RNA sequence gets copied into the genome rather than the L1's mRNA.[10]
Alu elements in primates form a fossil record that is relatively easy to decipher because Alu element insertion events have a characteristic signature that is both easy to read and faithfully recorded in the genome from generation to generation. The study of Alu Y elements (the more recently evolved) thus reveals details of ancestry because individuals will most likely only share a particular Alu element insertion if they have a common ancestor. This is because insertion of an Alu element occurs only 100 - 200 times per million years, and no known mechanism of deletion of one has been found. Therefore, individuals with an element likely descended from an ancestor with one—and vice versa, for those without. In genetics, the presence or lack thereof of a recently inserted Alu element may be a good property to consider when studying human evolution.[20]
Most human Alu element insertions can be found in the corresponding positions in the genomes of other primates, but about 7,000 Alu insertions are unique to humans.[21]
Impact in humans
Alu elements have been proposed to affect
However, the variation generated can be used in studies of the movement and ancestry of human populations,[26] and the mutagenic effect of Alu[27] and retrotransposons in general[28] has played a major role in the evolution of the human genome. There are also a number of cases where Alu insertions or deletions are associated with specific effects in humans:
Associations with human disease
Alu insertions are sometimes disruptive and can result in inherited disorders. However, most Alu variation acts as markers that segregate with the disease so the presence of a particular Alu allele does not mean that the carrier will definitely get the disease. The first report of Alu-mediated recombination causing a prevalent inherited predisposition to cancer was a 1995 report about hereditary nonpolyposis colorectal cancer.[29] In the human genome, the most recently active have been the 22 AluY and 6 AluS Transposon Element subfamilies due to their inherited activity to cause various cancers. Thus due to their major heritable damage it is important to understand the causes that affect their transpositional activity.[30]
The following human diseases have been linked with Alu insertions:[26][31]
- Alport syndrome
- Breast cancer
- chorioretinal degeneration
- Diabetes mellitus type II
- Ewing's sarcoma
- Familial hypercholesterolemia
- Hemophilia
- Leigh syndrome
- mucopolysaccharidosis VII
- Neurofibromatosis
- Macular degeneration[32]
And the following diseases have been associated with
- Alzheimer's disease
- Lung cancer
- Gastric cancer
The following disease have been associated with repeat expansion of AAGGG pentamere in Alu element :
- RFC1 mutation responsible of CANVAS (Cerebellar Ataxia, Neuropathy & Vestibular Areflexia Syndrome) [34]
Associated human mutations
- The ACE gene, encoding angiotensin-converting enzyme, has 2 common variants, one with an Alu insertion (ACE-I) and one with the Alu deleted (ACE-D). This variation has been linked to changes in sporting ability: the presence of the Alu element is associated with better performance in endurance-oriented events (e.g. triathlons), whereas its absence is associated with strength- and power-oriented performance.[35]
- The opsin gene duplication which resulted in the re-gaining of trichromacy in Old World primates (including humans) is flanked by an Alu element,[36] implicating the role of Alu in the evolution of three colour vision.
References
- S2CID 42804857.
- S2CID 45917758.
- S2CID 25273865.
- ^ Pray, Leslie (2008). "Functions and Utility of Alu Jumping Genes". Scitable.com. Nature. Retrieved 26 June 2019.
- PMID 17307271.
- PMID 8530063.
- ^ PMID 17020921.
- PMID 11560904.
- PMID 3387438.
- ^ PMID 18836035.
- S2CID 13091552.
- PMID 20019790.
- PMID 20713470.
- PMID 25550429.
- ^ PMID 7667273.
- S2CID 4328237.
- PMID 8790336.
- PMID 16344113.
- ^ S2CID 4427070.
- S2CID 8153502.
- S2CID 2638825.
- S2CID 45796017.
- PMID 9753719.
- PMID 11237011.
- S2CID 15651921.
- ^ S2CID 205486422.
- PMID 21282640.
- PMID 19763152.
- S2CID 39468812.
- PMID 29219079.
- PMID 22204421.
- S2CID 231761522.
- ^ "SNP in the promoter region of the myeloperoxidase MPO gene". SNPedia. Archived from the original on 2010-05-21. Retrieved 2010-03-14.[unreliable medical source?]
- PMID 30926972.
- S2CID 42531424.
- S2CID 10637615.
External links
- Alu+Repetitive+Sequences at the U.S. National Library of Medicine Medical Subject Headings (MeSH)
- "NCBI Genbank DNA encoding 7SL RNA". National Center for Biotechnology Information. 2018-05-12.