Haplogroup I-M170

Source: Wikipedia, the free encyclopedia.
(Redirected from
Haplogroup I (Y-DNA)
)
This article is about the human Y-DNA haplogroup. For the human mtDNA haplogroup, see Haplogroup I (mtDNA).
Haplogroup I-M170
Possible time of origin~42,900 Years BP [2]
Coalescence age~27,500 Years BP [3]
Possible place of origin
I2
Defining mutationsL41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, U179

Haplogroup I (M170) is a

Southeastern European
countries.

Haplogroup I appears to have arisen in Europe, so far being found in Palaeolithic sites throughout Europe (Fu 2016), but not outside it. It diverged from common ancestor IJ* about 43,000 years B.P. (Karafet 2008). Early evidence for haplogroup J has been found in the Caucasus and Iran (Jones 2015, Fu 2016). In addition, living examples of the precursor Haplogroup IJ* have been found only in Iran, among the

South West Asia
.

Haplogroup I has been found in multiple individuals belonging to the Gravettian culture. The Gravettians expanded westwards from the far corner of Eastern Europe, likely Russia, to Central Europe. They are associated with a genetic cluster that is normally called the Věstonice cluster.[2][3][4]

Origins

BP
.
  Solutrean and Proto-Solutrean Cultures
  Epi-Gravettian Culture

Available evidence suggests that I-M170 was preceded into areas in which it would later become dominant by haplogroups

Kostenki 14 (south west Russia) C1b, and Goyet Q116-1 (Belgium) C1a.[5][6] The oldest I-M170 found is that of an individual known as Krems WA3 (lower Austria), dating from circa 33,000-24,000 BP. At the same site, two twin boys were also found, both were assigned to haplogroup I*.[7][8]

Haplogroup IJ was in the Middle East and/or Europe about 40,000 years ago.[citation needed] The TMRCA (time to most recent common ancestor) for I-M170 was estimated by Karafet and colleagues in 2008 to be 22,200 years ago, with a confidence interval between 15,300 and 30,000 years ago.[9] This would make the founding event of I-M170 approximately contemporaneous with the Last Glacial Maximum (LGM), which lasted from 26,500 years ago until approximately 19,500 years ago.[10] TMRCA is an estimate of the time of subclade divergence. Rootsi and colleagues in 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I-M170 they estimate time to STR variation as 24,000 ±7,100 years ago and time to population divergence as 23,000 ±7,700 years ago.[11] These estimates are consistent with those of Karafet 2008 cited above. However, Underhill and his colleagues calculate the time to subclade divergence of I1 and I2 to be 28,400 ±5,100 years ago, although they calculate the STR variation age of I1 at only 8,100 ±1,500 years ago.[12]

Semino (2000) speculated that the initial dispersion of this population corresponds to the diffusion of the

Haplogroup C, was found in human remains belonging to the previously mentioned Gravettian culture and in individuals of the Magdalenian and Azilian cultures.[14] Rootsi and colleagues in 2004 suggested that each of the ancestral populations now dominated by a particular subclade of Haplogroup I-M170 experienced an independent population expansion immediately after the Last Glacial Maximum.[11]

The five known cases of Haplogroup I from

Haplogroup C1b have been documented, once each, on older remains in Europe. I2 subclade of I-M170 is the main haplogroup found on male remains in Mesolithic Europe, until circa 6,000 BCE, when mass migration into Europe of Anatolian farmers carrying Y-DNA G2a happened.[16]

Due to the arrival of so-called

Haplogroup G among Neolithic European remains and by Haplogroup R
in later remains.

The earliest documentation of

I1
is from Neolithic Hungary, although it must have separated from I2 at an earlier point in time.

In one instance, haplogroup I was found far from Europe, among 2,000-year-old remains from Mongolia.[17]

It would seem to be that separate waves of population movement impacted

Southeastern Europe. The role of the Balkans as a long-standing corridor to Europe from Anatolia and/or the Caucasus
is shown by the common phylogenetic origins of both haplogroups I and J in the parent haplogroup IJ (M429). This common ancestry suggests that the subclades of IJ entered the Balkans from Anatolia or the Caucasus, some time before the Last Glacial Maximum. I and J were subsequently distributed in Asia and Europe in a disjunctive phylogeographic pattern typical of "sibling" haplogroups. A natural geographical corridor like the Balkans is likely to have been used later by members of other subclades of IJ, as well as other haplogroups, including those associated with Early European Farmers.

The existence of Haplogroup IJK – the ancestor of both haplogroups IJ and K (M9) – and its evolutionary distance from other subclades of Haplogroup F (M89), supports the inference that haplogroups IJ and K both arose in Southwestern Asia. Living carriers of F* and IJ* have been reported from the Iranian Plateau.[1]

Distribution

Frequencies of Haplogroup I:

Population % hg I % hg I (Subpopulation) Sampled individuals Source
Abazinians
 3.4 88 Sergeevich 2007[18]
Abkhazians 33.3 12 Nasidze Ivan 2004[19]
Adyghe (Adygea) 7 154 [20]
Cherkessia
)		 2 126 Sergeevich 2007[18]
Adyghe (Kabardia) 10 59 Nasidze Ivan 2004[19]
Afghanistan 3 (
Hazara people
) 		60 El Sibai 2009[21]
Afghanistan 1.5% 3.3% (2/60)
Hazara, 1.8% (1/56) Tajik
 204 Haber et al. 2012[22]
Afghanistan 0.99% 2.6% (2/77)
Hazara, 2.1% (3/142) Tajiks, 0/74 Turkmens, 0/87 Pashtuns, 0/127 Uzbeks
 507 Di Cristofaro 2013[23]
Albanians 13% (29/223) (Albania) 223 Sarno 2015
Albanians 16 (
Gheg
) 		Ferri 2010
Albanians 21.82% (12/55) (Tirana) 55 Battaglia 2008
Albanians 7 (Tirana) 30 Bosch 2006
Algerians 0 156 [24]
Andis 27
Armenians 5 FTDNA 2013[25]
Avars 2 115 Balanovsky
Austrians 28 50 (
Tyrol
) 		[26]
Ashkenazi
 1 1099 [27]
Azeri 3 72 Nasidze Ivan 2004
Balkars 3 135 Kutuev 2007[28]
Belarusians 23 11 (West), 15 (North), 16 (East), 28 (Centre), 30 (East
Polesie
), 34 (West Polesie) 		565 Kushniarevich 2013
Belarusians 32
Polesie
- 43 (Vichin), 12 (Avtyuki) 		204 Sergeevich 2015[29]
Bosnia and Herzegovina 53 73 (Croats), 49 (Bosniaks), 33 (Serbs) 256 Marjanovic 2006
Bosnia and Herzegovina 65 Herzegovina- 71 (
Siroki Brijeg), Bosnia- 54 (Zenica
) 		210 Pericic 2005[30]
Bosnia and Herzegovina 73 (Croats), 45 (Bosniaks), 36 (Serbs) 255 Battaglia 2008[31]
Bulgarians 27-29 40 (Varna), 32 (Sofia), 30 (Plovdiv), 10 (Haskovo) 935 Karachanak 2009–13[32][33]
Bulgarians 34 100 Begona Martinez-Cruz 2012
Bulgaria 19 (Bulgarian Turks) 63 Zaharova 2002[34]
Central Asia 2 984 Rootsi 2004
Chechens 0 330 Balanovsky
Croats 45 1100 Mrsic 2012
Croats 47 55 (Hvar), 52 (Osijek), 41 (Pula), 57 (Split), 29 (Varaždin) 518 Primorac 2022[35]
Cyprus 1 164 El-Sibai 2009[36]
Czechs 18 25 (Klatovy), 25 (Písek), 15 (Brno) 14 (Hradec Králové), 10 (Třebíč) 257 Luca 2007[37]
Danes 49 194 Rootsi 2004
Darginians
 58 26 Nasidze Ivan 2004
Darginians
(Kaitak)		 0 101
Dutch 27.8 2085 Altena 2020[38]
Dutch 33 410 Van Doorn 2008[39]
Egyptians 0 124 El-Sibai 2009[40]
Egyptians 1 370 [24]
Estonians 19 194 Rootsi 2004
English 18 945 Rootsi 2004
English 26 12 (Cornwall), 38 (Essex) 1830 FTDNA 2016[41]
Estonians 17 118 Lappalainen 2008[42]
Flemish Belgians 28 113 [43]
Finland 29 36 (Swedes from Ostrobothnia), 15 (
Northern Savo
) 		536 Lappalainen 2006[44]
French 16 (South), 24 (Normandy), 4 (Lyon), 4 (Corsica) Rootsi 2004
French 9 5 (
Nord Pas de Calais
) 		555 Ramos-Luis 2009[45]
French 13 11 (Paris), 18 (Strasburg), 10 (Lyon) 333 Kari Hauhio[26]
Gagauzes
 28 89 Varzari 2006
Georgians 0 63 Rootsi 2004
Georgians 4 77 Nasidze Ivan 2004
Germans 24 32 (Berlin), 32 (Hamburg), 15 (Leipzig) 1215 Kayser 2005[46]
Greeks 14 30 (Macedonia) 261 Rootsi 2004
Greeks 10 (Athens), 30 (Macedonia) 149 Battaglia 2008
Greeks 36 (
Patrai), 12 (Karditsa), 8 (Ioannina), 2 (Chios
) 		366 Di Giacommo 2003[47]
Greeks 12 (North), 24 (South) 142 Zalloua 2008
Greenlanders
 17 215 Sanchez 2004[48]
Hungarians 23 162 Rootsi 2004
Hungarians 28 230 Vago Zalan Andrea 2008
Indians 0 (North India) 560 [49]
Ingush 0 143
Iranians 2 22 (South Iran), 5 (
Teheran
) 		186 Di Cristofaro 2013[23]
Iranians 1 (West), 1 (East) 324 [50]
Iranians 0 83 Rootsi 2004
Iranians 1 92 El-Sibai 2009[36]
Iranians 0 6 (
Khorasan, Yazd
) 		952 Grugni 2012
Iraqis 1 176 Rootsi 2004[51]
Iraqis 1 117 El-Sibai 2009[36]
Irish 11 76 Rootsi 2004
Irish 10 119 Cappeli 2013[52]
Irish 11 (Rush, Dublin) Capelli 2003
Italians 5 (North), 7 (Central), 9 (South and Sicily), 39 (Sardinia) Rootsi 2004
Italians 10 31 (Sardinia), 4 (Umbria, Marche) 884 Boattini 2013[53]
Italians 7 0 (
Val di Non), 5 (Verona), 7(Genoa), 19 (Foggia
) 		524 Di Giacomo 2003[54]
Italians 36 (Filettino) 35 (Cappadocia, Abruzzo), 28 (Vallepietra) Messina 2015[55]
Italians 23 (
Latini
) 		583 Brisighelli 2012[56]
Italians 30 (Stelvio) [57]
Italians 31 (Caccamo) Gaetano 2008[58]
Jordanians
 1 273 El-Sibai 2009[36]
Jordanians
 5 (Amman), 0 (Dead Sea) 146 Flores 2005[59]
Kara
Nogays
 13 76
Karachays 9 69 Sergeevich 2007[18]
Kazakhs 1 370 [60]
Kosovar Albanians
 8 114 Pericic 2005
Kumyks 0 73 Kutuev 2007[28]
Kurds 4 (West Iran) 21 Malyarchuk 2013[61]
Kurds 2 (Iran) 59 Gragni 2012
Kurmanji 17 (Turkey), 0 (Georgia) 112 Nasidze 2005[62]
Kuwaiti 0 42 El-Sibai 2009[36]
Kyrgyzstan 0 (Uyghurs), 0 (Kyrgyz) Di Cristofaro 2013[23]
Laks
 14 [63]
Latvians 9 3 (Southwest) [64]
Lebanese 3 10 (North
Shia
) 		951 [36][65]
Lebanese 5 66 Rootsi 2004
Lezgis
 0 81
Lithuanians 7 Kushniarevich 2015
Libyans
 0 83 [24]
Libyans
 2 1 175 Fendri 2015[66]
Macedonians 34 (Skopje) 79 Pericic 2005
Macedonians 24 31 (Macedonians), 12 (Albanians) 343 Noevski 2010
Macedonians 13 (Albanians) 64 Battaglia 2008[31]
Maltese 12 90 El-Sibai 2009[36]
Moldovans 29 (Moldovans), 25 (Ukrainians) Varzari 2006
Moroccans 0 316 El-Sibai 2009[36]
Moroccans 0 760 [24]
Mongols 1 160 Di Cristofaro 2013[23]
Norwegians 37 40 (Oslo) 30 (West), 42 (East, South), 35 (North), 33 (Bergen) Dupuy 2005
Pakistan 0 638 [67]
Poles 17 19 (Warsaw), 12 (Lublin), 22 (Szczecin) 913 Kayser 2005
Poles 18 191 Rootsi 2004
Portuguese 5 303 Rootsi 2004
Portuguese 8 3 (
Setubal), 18 (Braga
) 		657 Beleza 2005[68]
Qatar 0 72 El-Sibai 2009[36]
Romani 17 (Hungary), 10 (
Tiszavasvari), 5 (Tokaj
) 37 (Taktakoz), 11 (Slovakia) 		Vago Zalan Andrea 2008
Romanians 28 36 (
Cluj
) 		178 Martinez-Cruz 2012[69]
Romanians 22 361 Rootsi 2004
Russians 13 (North Europe), 18 (Centre Europe), 21 (South Europe), 27 (Unzha), 0 (Mezen) 1228 Balanovsky 2008
Russia 2 (
Chuvashes), 19 (Kostroma), 11 (Smolensk), 17 (Belgorod), 19 (Mordvins), 23 (Cossacks), 24 (Adygea
) 		Rootsi 2004
Saami
 31 Rootsi 2004
Saudis
 0 1597 [70]
Scotland 11 17 (
Scottish Isles
) 		Rootsi 2004
Sephardi
 4 (Portugal) 57
Serbs 39 Serbia with Kosovo 209 Zgonjanin 209[71]
Serbs 48 (Serbia), 39 (Kosovo), 52 (Herzegovina and Montenegro) 1200 Mihajlovic 2022[72]
Slovaks 28 250 Petrejcikova 2013[73]
Slovenians
 30 57 (
Spodnjeposavska
) 		458 Vakar 2010[74]
Spaniards 6 18 (Asturias), 0 (Gascony) 1002 Adams 2008[75]
Sudanese 5 (Nubians), 4 (Gaalien), 7 (Mesereia) [76]
Swedes 42 32 (Ostergotaland & Jonkoping) 50 (
Varmland
) 		305 Karlsson2006[77]
Swedes 26 (North Sweden),[78] Rootsi2004
Swedes 41 (South), 26 (North) Rootsi 2004
Swedes 44 60 (
Kronoberg), 55 (Stockholm), 37 (North Norrland
), 52 (South Norrland) 		1800 FTDNA 2016[79]
Swiss 8 144 Rootsi 2004
Swiss 23 13 (Lausanne), 32 (Bern) [26]
Syrians 2 (West), 3 (East) 520 [50]
Syrians 2 554 El Sibai 2009[36]
Tataers 33 (China) 33 [80]
Tunisians 0 El-Sibai 2009[36]
Tunisians 0 601 [24]
Turks 5 12 (
Eastern Anatolia
) 		523 Cinnioglu 2003
Turks 5 741 Rootsi 2004
UAE
 0 164 El-Sibai 2009[36]
Ukrainians 22 585 Rootsi 2004
Ukrainians 28 33 (Sumy), 23 (Ivano-Frankivsk) 701 Kushniarevich 2013
Welsh 8 196 Rootsi 2004
Yemenese 0 62 El-Sibai 2009[36]
Zazas 33 (Turkey) 27 Nasidze 2005[62]
17 (
Constanta), 39 (Romanians
in Piteşti) 		Bosch 2006[81]
47 (
Kongaz
), 25 (Ukrainians from Rashkovo) 		Vazari 2006
38 (
Eastern Finland), 18 (Karelia), 12 (Lithuania), 7 (Latvia), 17 (Estonia
) 		Lappalainen2008[82]
34 (
Teheran), 10 (Iranians from Isfahan), 32 (Ossetians from Ardon), 13 (Ossetians from Digora
) 		Nasidze Ivan. 2004[19]
3 (Tajiks) 3 (East Persians) Malyarchuk 2013[61]
2 (
Tuvinians
)

Subgroups

The subclades of Haplogroup I-M170 with their defining mutations, as of 2011.[83] Up-to-date phylogenetic trees listing all currently known subclades of I can be found at Y-Full and FamilyTreeDNA

Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer.

I-M170

The composite subclade I-M170 contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.

Several I* individuals, who do not fall into any known subclades, have been found among the

Adygea in the Caucasus (2/138) and Iraq
(1/176), even though I-M170 occurs at only very low frequencies among modern populations of these regions as a whole. This is consistent with the belief that the haplogroup first appeared in South West Eurasia.

There are also high frequencies of Haplogroup I* among the

Saami (1/35).[87]

(Neither study from which the above figures were drawn excluded the present I2-M438 clade as a whole, but only certain subclades, so these presumed cases I* may possibly belong to I2.)

A living

Hazara male from Afghanistan has also been found to carry I*, with all known subclades of both I1 (M253) and I2 (M438) ruled out.[88]

I1-M253

Main article: Haplogroup I-M253

Haplogroup I1-M253 (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic-influenced world. A notable exception is Finland, where frequency in West Finns is up to 40%, and in certain provinces like Satakunta more than 50%. I1 is believed to have become common as a result of a founder effect during the Nordic Bronze Age, and subsequently spread throughout Europe during the Migration Period when Germanic tribes migrated from southern Scandinavia and northern Germany to other places in Europe.[89]

Outside

Italians, despite the much lower overall frequency of Haplogroup I1-M253 among the modern French and Italian populations. This, along with the structure of the phylogenetic tree of I1-M253 strongly suggests that most living I1 males are the descendants of an initially small group of reproductively successful men who lived in Scandinavia during the Nordic Bronze Age.[90][91]

I2-M438

Main article: Haplogroup I-M438

Haplogroup I2-M438, previously I1b, may have originated in southern Europe – it is now found at its highest frequencies in the western Balkans and Sardinia – some 15,000–17,000 years ago and developed into three main subgroups : I2-M438*, I2a-L460, I2b-L415 and I2c-L596.

I2a1a-M26

Haplogroup I2a1a-M26 is notable for its strong presence in Sardinia. Haplogroup I-M170 comprises approximately 40% of all patrilines among the

Sardinians
, and I2a1a-M26 is the predominant type of I among them.

Haplogroup I2a1a-M26 is practically absent east of France and Italy,

Basques, but appears to be found at somewhat higher frequencies among the general populations of Castile-León in Spain and Béarn in France than among the population of ethnic Basques.[citation needed] The M26 mutation is found in native males inhabiting every geographic region where megaliths may be found, including such far-flung and culturally disconnected regions as the Canary Islands, the Balearic Isles, Corsica, Ireland, and Sweden.[92]

The distribution of I2a1a-M26 also mirrors that of the Atlantic Bronze Age cultures, which indicates a potential spread via the obsidian trade or a regular maritime exchange of some of metallurgical products.[92]

I2a1b-M423

The approximate frequency and variance distribution of haplogroup I-P37 clusters, ancestral "Dnieper-Carpathian" (DYS448=20) and derived "Balkan" (DYS448=19: represented by a single SNP I-PH908), in Eastern Europe per O.M. Utevska (2017).

Haplogroup I2a1b-M423 is the most frequent Y-chromosome haplogroup I-M170 in Central and Eastern European populations, reaching its peak in the

Bosnia-Herzegovina (up to 71%,[93] avg. 40-50%[30]). Its subclade I-L161 has greater variance in Ireland and Great Britain, but overall frequency is very low (2–3%), while subclade I-L162 has the highest variance and also high concentration in Eastern Europe (Ukraine, Southeastern Poland, Belarus).[94]

I2a2-M436

The distribution of Haplogroup I2a2-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32) is closely correlated to that of Haplogroup I1 except in Fennoscandia, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I1-M253; the lack of correlation between the distributions of I1-M253 and I2a2-M436 in Fennoscandia may be a result of Haplogroup I2a2-M436's being more strongly affected in the earliest settlement of this region by founder effects and genetic drift due to its rarity, as Haplogroup I2a2-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of Lower Saxony. Haplogroup I2a2-M436 has been found in over 4% of the population only in Germany, the Netherlands, Belgium, Denmark, England (not including Cornwall), Scotland, and the southern tips of Sweden and Norway in Northwest Europe; the provinces of Normandy, Maine, Anjou, and Perche in northwestern France; the province of Provence in southeastern France; the regions of Tuscany, Umbria, and Latium in Italy; and Moldavia and the area around Russia's Ryazan Oblast and Republic of Mordovia in Eastern Europe. One subclade of Haplogroup I2a2-M436, namely I2a2a1a1-M284, has been found almost exclusively among the population of Great Britain, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I1-M253 and Haplogroup I2a2-M436 seem to correlate fairly well with the extent of historical influence of Germanic peoples. The punctual presence of both haplogroups at a low frequency in the area of the historical regions of Bithynia and Galatia in Turkey may be related to the Varangian Guard or rather suggests a connection with the ancient Gauls of Thrace, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of Nicomedes I of Bithynia. This suggestion is supported by recent genetic studies regarding Y-DNA Haplogroup I2b2-L38 have concluded that there was some Late Iron Age migration of Celtic La Tène people, through Belgium, to the British Isles including north-east Ireland.[95]

Haplogroup I2a2-M436 also occurs among approximately 1% of

Hazaras from Afghanistan at 3%.[96]

Specifications of mutation

The technical details of U179 are:

Nucleotide change (rs2319818): G to A
Position (base pair): 275
Total size (base pairs): 220
Forward 5′→ 3′: aaggggatatgacgactgatt
Reverse 5′→ 3′: cagctcctcttttcaactctca

Height

This haplogroup reaches its maximum frequency in the Western Balkans (with the highest concentration of I2 in present-day

haplogroups I1, R1b-U106, I2a1b-M423 and tall males.[98] The study featured the measured average heights of young German, Swedish, Dutch, Danish, Serbian and Bosnian men. The German male average height was 180.2 cm, the Swedish men were on average 181.4 cm, the Dutch men were 183.8 cm, the Danish men were 180.6 cm, the Serbians were 180.9 cm, and Bosnian Croat
men from Herzegovina were 185.2 centimeters on average.

See also

Notes

  • Barać L, Pericić M, Klarić IM, et al. (July 2003). "Y chromosomal heritage of Croatian population and its island isolates" (PDF). Eur. J. Hum. Genet. 11 (7): 535–42.
    S2CID 15822710
    .
  • Bennett, E.A., Prat, S., Péan, S., Crépin, L., Yanevich, A., Puaud, S., ... & Geigl, E. M. (2019). The origin of the Gravettians: genomic evidence from a 36,000-year-old Eastern European. BioRxiv, 685404.
  • Rootsi, S, Kivisild, T, Benuzzi, G, Help, H, et al. (2019). "Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in Europe". Am. J. Hum. Genet. 75 (1): 128–137.
    S2CID 2834639
    .
  • The Genographic Project, National Geographic, Atlas of the Human Journey
  • ISOGG, Y-DNA Haplogroup I and its Subclades

References

  1. ^
    PMID 22815981
    .
  2. ^ "Publications Detail View". fgga.univie.ac.at. Retrieved 2020-12-15.
  3. PMID 33318530
    .
  4. S2CID 198249005
    .
  5. PMID 27135931
    .
  6. ^ Seguin-Orlando et al. (2014)「Genomic structure in Europeans dating back at least 36,200 years」
  7. PMID 33159107
    .
  8. ^ "Y-SNP calls for Krems WA3". Genetiker. 2016-05-11. Retrieved 2020-12-15.
  9. PMID 18385274
    .
  10. S2CID 1324559
    .
  11. ^
    PMID 15162323
    .
  12. ^ P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.), Rethinking the Human Evolution (2007), pp. 33–42.
  13. PMID 11073453
    .
  14. ^ a b "Palaeolithic DNA from Eurasia". Archived from the original on 2016-10-03. Retrieved 5 October 2016.
  15. PMID 27135931
    .
  16. ^ "Ancient DNA reveals 'genetic continuity' between Stone Age and modern populations in East Asia". February 2017.
  17. PMID 12858290.[dead link
    ]
  18. ^ a b c ИЗУЧЕНИЕ ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ НАРОДОВ ЗАПАДНОГО КАВКАЗА ПО ДАННЫМ О ПОЛИМОРФИЗМЕ Y-ХРОМОСОМЫ, МИТОХОНДРИАЛЬНОЙ ДНК И ALU-ИНСЕРЦИЙ
  19. ^
    S2CID 27204150. Archived from the original
    (PDF) on 2017-01-18. Retrieved 2016-10-09.
  20. ^ Yunusbayev 2011
  21. PMID 22470552
    .
  22. PMID 22470552
    .
  23. ^ a b c d Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge
  24. ^ a b c d e Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape
  25. ^ "Armenian DNA Project". Archived from the original on 2016-10-11. Retrieved 2016-10-08.
  26. ^ a b c "Where did European men come from?" (PDF). www.jogg.info. 2008. Retrieved 2019-06-07.
  27. ^ "Comments on 2014 Klyosov Article on Jewish DNA Genealogy p. 1 of 2 - Levite DNA". Archived from the original on 2016-11-12. Retrieved 2016-10-09.
  28. ^ a b Кутуев Ильдус Альбертович. Генетическая структура и молекулярная филогеография народов кавказа
  29. ^ ВКЛАД ОТДЕЛЬНЫХ ПОЛЕССКИХ ПОПУЛЯЦИЙ И ПОПУЛЯЦИИ БЕЛОРУССКИХ ТАТАР В ГЕНОФОНД НАСЕЛЕНИЯ БЕЛАРУСИ [1]
  30. ^
    PMID 15944443
    .
  31. ^
    PMID 19107149
    .
  32. ISSN 1310-1331. INIST 21359873
    .
  33. PMID 23483890
    .
  34. ^ "Bulgarian_Y_Table.xlsx".
  35. PMID 35722696
    .
  36. ^ a b c d e f g h i j k l m Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
  37. ^ Y-chromosomal variation in the Czech Republic
  38. ^ Altena, E., Smeding, R., van der Gaag, K.J. et al. The Dutch Y-chromosomal landscape. Eur J Hum Genet 28, 287–299 (2020). https://doi.org/10.1038/s41431-019-0496-0
  39. ^ ZONEN VAN ADAM IN NEDERLAND Genetische genealogie : een zoektocht in ons DNA-archief
  40. PMID 19686289
    .
  41. ^ "Photo" (PNG). s-media-cache-ak0.pinimg.com. Retrieved 2019-06-07.
  42. ^ Migration Eaves to the Baltic Region
  43. ^ "Y Haplogroup Frequencies in the Flemish Populstion".
  44. PMID 16644145
    .
  45. S2CID 85134429
    .
  46. S2CID 11066186
    .
  47. ^ "Archived copy" (PDF). Archived from the original (PDF) on 2017-01-20. Retrieved 2016-10-08.{{cite web}}: CS1 maint: archived copy as title (link)(subscription required)
  48. doi:10.1016/S0531-5131(03)01635-2
    .
  49. ^ Presence of three different paternal lineages among North Indians: a study of 560 Y chromosomes (2009)
  50. ^ a b Influences of history, geography, and religion on genetic structure: the Maronites in Lebanon
  51. PMID 15024688
    .
  52. ^ A Y Chromosome Census of the British Isles
  53. ^ Uniparental Markers in Italy Reveal a Sex-Biased Genetic Structure and Different Historical Strata
  54. ^ Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects
  55. ^ Traces of forgotten historical events in mountain communities in Central Italy: A genetic insight
  56. ^ Uniparental Markers of Contemporary Italian Population Reveals Details on Its Pre-Roman Heritage
  57. ^ Genetic Structure in Contemporary South Tyrolean Isolated Populations Revealed by Analysis of Y-Chromosome, mtDNA, and Alu Polymorphisms
  58. ^ Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome
  59. ^ Isolates in a corridor of migrations: A high-resolution analysis of Y-chromosome variation in Jordan
  60. ^ Вестник Московского университета. Серия XXIII АНТРОПОЛОГИЯ № 1/2014: 96–101СВЯЗЬ ИЗМЕНЧИВОСТИ Y ХРОМОСОМЫ И РОДОВОЙСТРУКТУРЫ: ГЕНОФОНД СТЕПНОЙ АРИСТОКРАТИИИ ДУХОВЕНСТВА КАЗАХОВ
  61. ^ a b Y chromosomes in Iranians and Tajiks
  62. ^ a b MtDNA and Y-chromosome Variation in Kurdish Groups
  63. ^ The dual origin of tati-speakers from dagestan as written in the genealogy of uniparental variants
  64. ^ Pliss et al. Y-Chromosomal Lineages of Latvians in the Contextof the Genetic Variation of the Eastern-Baltic Region
  65. ^ Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events
  66. ^ Paternal lineages in Libya inferred from Y-chromosome haplogroups
  67. ^ Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan (2006)
  68. ^ Micro-Phylogeographic and Demographic History of Portuguese Male Lineages
  69. PMID 22848614
    .
  70. ^ Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions.
  71. PMID 28789900
    .
  72. S2CID 251658864
    .
  73. ^ The genetic structure of the Slovak population revealed by Y-chromosome polymorphisms
  74. ^ ANALIZA Y-DNK HAPLOTIPOV SLOVENCEV
  75. ^ Adams et al. The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula
  76. ^ Y-Chromosome Variation Among Sudanese: Restricted Gene Flow, Concordance With Language, Geography, and History
  77. PMID 16724001
    .
  78. PMID 15162323
    .
  79. ^ "Swedish Haplogroup Database (Stats haplopie)". Archived from the original on 2016-10-10. Retrieved 2016-10-08.
  80. ^ Y-chromosome distributions among populations in Northwest China identify significant contribution from Central Asian pastoralists and lesser influence of western Eurasians (2010)
  81. S2CID 23156886
    .
  82. S2CID 32079904
    .
  83. ^ ISOGG 2011
  84. S2CID 10763736
    .
  85. ^ "ISOGG 2017 Y-DNA Haplogroup I". isogg.org.
  86. ^
    PMID 19911015
    .
  87. PMID 15162323
    .
  88. PMID 24204668
    .
  89. S2CID 4399103
    .
  90. PMID 19781941
    .
  91. PMID 16724001
    .
  92. ^ a b c Rootsi; et al. "Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe figure 1" (PDF). Archived from the original (PDF) on 2007-03-03.
  93. S2CID 36632274.[dead link
    ]
  94. ^ O.M. Utevska (2017). Генофонд українців за різними системами генетичних маркерів: походження і місце на європейському генетичному просторі [The gene pool of Ukrainians revealed by different systems of genetic markers: the origin and statement in Europe] (PhD) (in Ukrainian). National Research Center for Radiation Medicine of National Academy of Sciences of Ukraine. pp. 219–226, 302.
  95. ISBN 978-1-84217-410-4
    .
  96. PMID 22470552
    .
  97. PMID 28484621
    .
  98. PMID 25190282
    .

External links

Wikimedia Commons has media related to Haplogroup I of Y-DNA.

Phylogenetic tree and distribution maps

Projects

Other

Retrieved from "https://en.wikipedia.org/w/index.php?title=Haplogroup_I-M170&oldid=1193791589"