T7 RNA polymerase
 | This article includes a list of general references, but it lacks sufficient corresponding inline citations. (March 2019) |
| T7 RNA polymerase | |||||||
|---|---|---|---|---|---|---|---|
UniProt P00573 | | ||||||
| |||||||
T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction.[1]
Activity
T7 polymerase is extremely
Promoter
The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is:[2]
5' * 3'
T7 TAATACGACTCACTATAGGGAGA
T3 AATTAACCCTCACTAAAGGGAGA
K11 AATTAGGGCACACTATAGGGAGA
SP6 ATTTACGACACACTATAGAAGAA
bind------------
-----------init
Transcription begins at the asterisk-marked guanine.[2]
Structure
T7 polymerase has been crystallised in several forms and the structures placed in the
Similar to other viral nucleic acid polymerases, including T7 DNA polymerase from the same phage, the conserved C-terminal of T7 ssRNAP employs a fold whose organization has been likened to the shape of a right hand with three subdomains termed fingers, palm, and thumb.[4] The N-terminal is less conserved. It forms a promoter-binding domain (PBD) with helix bundles in phage ssRNAPs,[5] a feature not found in mitochondrial ssRNAPs.[6]
Related proteins
| DNA-directed RNA polymerase, phage-type | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Identifiers | |||||||||
| Symbol | RNA_pol | ||||||||
SCOP2 | 1msw / SCOPe / SUPFAM | ||||||||
| |||||||||
T7 polymerase is a representative member of the single-subunit DNA-dependent RNAP (ssRNAP) family. Other members include phage T3 and SP6 RNA polymerases, the mitochondrial RNA polymerase (POLRMT), and the chloroplastic ssRNAP.[7][8] The ssRNAP family is structurally and evolutionarily distinct from the multi-subunit family of RNA polymerases (including bacterial and eukaryotic sub-families). In contrast to bacterial RNA polymerases, T7 polymerase is not inhibited by the antibiotic rifampicin. This family is related to single-subunit reverse transcriptase and DNA polymerase.[9]
Application
In biotechnology applications, T7 RNA polymerase is commonly used to transcribe DNA that has been cloned into vectors that have two (different) phage promoters (e.g., T7 and T3, or T7 and SP6) in opposite orientation. RNA can be selectively synthesized from either strand of the insert DNA with the different polymerases. The enzyme is stimulated by spermidine and in vitro activity is increased by the presence of carrier proteins (such as BSA).[10][11]
Homogeneously labeled single-stranded RNA can be generated with this system. Transcripts can be non-radioactively labeled to high specific activity with certain labeled nucleotides.
T7 RNA polymerase is used in the synthesis of mRNA and sgRNA.[12]
See also
References
Further reading
- Martin CT, Esposito EA, Theis K, Gong P (2005). "Structure and function in promoter escape by T7 RNA polymerase". Progress in Nucleic Acid Research and Molecular Biology. 80: 323–47. PMID 16164978.
- Sousa R, Mukherjee S (2003). "T7 RNA polymerase". Progress in Nucleic Acid Research and Molecular Biology. 73: 1–41. PMID 12882513.
- McAllister WT (1993). "Structure and function of the bacteriophage T7 RNA polymerase (or, the virtues of simplicity)". Cellular & Molecular Biology Research. 39 (4): 385–91. PMID 8312975.
- Sastry SS, Ross BM (March 1997). "Nuclease activity of T7 RNA polymerase and the heterogeneity of transcription elongation complexes". The Journal of Biological Chemistry. 272 (13): 8644–52. PMID 9079696. - note that the nuclease activity reported here is an artifact.