Congenital stationary night blindness
Congenital stationary night blindness | |
---|---|
Malfunction in transmission from the photoreceptors in the outer nuclear layer to bipolar cells in the inner nuclear layer underlies CSNB. | |
Specialty | Ophthalmology |
Congenital stationary night blindness (CSNB) is a rare non-progressive
Congenital stationary night blindness (CSNB) can be inherited in an X-linked,
Two forms of CSNB can also affect horses, one linked to the leopard complex of equine coat colors and the other found in certain horse breeds. Both are autosomal recessives.[4][5]
Symptoms and signs
The X-linked varieties of congenital stationary night blindness (CSNB) can be differentiated from the autosomal forms by the presence of
Cause
CSNB is caused by malfunctions in neurotransmission from
The
Genetics
Only three
Pathophysiology
CSNB1
The complete form of X-linked congenital stationary night blindness, also known as
Mutation | Position | References | |
---|---|---|---|
Nucleotide | Amino acid | ||
c.?-1_?-61del | 1_20del | Signal sequence | [17] |
Splicing | Intron 1 | [19] | |
c.?-63_1443-?del | 21_481del | [17] | |
c.48_64del | L18RfsX108 | Signal sequence | [19] |
c.85_108del | R29_A36del | N-terminal LRR | [16] |
c.G91C | C31S | LRRNT | [17] |
c.C105A | C35X | LRRNT | [17] |
c.C169A | P57T | LRRNT | [20] |
c.C191A | A64E | LRR1 | [20] |
c.G281C | R94P | LRR2 | [21] |
c.301_303del | I101del | LRR2 | [17] |
c.T302C | I101T | LRR2 | [21] |
c.340_351del | E114_A118del | LRR3 | [17][19] |
c.G427C | A143P | LRR4 | [17] |
c.C452T | P151L | LRR4 | [16] |
c.464_465insAGCGTGCCCGAGCGCCTCCTG | S149_V150dup+P151_L155dup | LRR4 | [16] |
c.C524G | P175R | LRR5 | [17] |
c.T551C | L184P | LRR6 | [16] |
c.556_618delins | H186?fsX260 | LRR6 | [16] |
c.559_560delinsAA | A187K | LRR6 | [17] |
c.613_621dup | 205_207dup | LRR7 | [16][17] |
c.628_629ins | R209_S210insCLR | LRR7 | [16] |
c.T638A | L213Q | LRR7 | [16] |
c.A647G | N216S | LRR7 | [16][19] |
c.T695C | L232P | LRR8 | [16] |
c.727_738del | 243_246del | LRR8 | [17] |
c.C792G | N264K | LRR9 | [16] |
c.T854C | L285P | LRR10 | [16] |
c.T893C | F298S | LRR10 | [16] |
c.C895T | Q299X | LRR10 | [19] |
c.T920C | L307P | LRR11 | [17] |
c.A935G | N312S | LRR11 | [17] |
c.T1040C | L347P | LRRCT | [17] |
c.G1049A | W350X | LRRCT | [16] |
c.G1109T | G370V | LRRCT | [17] |
c.1122_1457del | S374RfsX383 | LRRCT | [17][19] |
c.1306del | L437WfsX559 | C-terminus | [19] |
LRR: leucine-rich repeat, LRRNT and LRRCT: N- and C-terminal cysteine-rich LRRs. |
CSNB2
The incomplete form of X-linked congenital stationary night blindness (CSNB2) is caused by mutations in the CACNA1F gene, which encodes the voltage-gated calcium channel CaV1.4 expressed heavily in retina.[22][23] One of the important properties of this channel is that it inactivates at an extremely low rate. This allows it to produce sustained Ca2+ entry upon depolarization. As photoreceptors depolarize in the absence of light, CaV1.4 channels operate to provide sustained neurotransmitter release upon depolarization.[24] This has been demonstrated in CACNA1F mutant mice that have markedly reduced photoreceptor calcium signals.[25] There are currently 55 mutations in CACNA1F located throughout the channel, Table 2 and Figure 1. While most of these mutations result in truncated and, likely, non-functional channels, it is expected that they prevent the ability of light to hyperpolarize photoreceptors. Of the mutations with known functional consequences, 4 produce channels that are either completely non-functional, and two that result in channels which open at far more hyperpolarized potentials than wild-type. This will result in photoreceptors that continue to release neurotransmitter even after light-induced hyperpolarization.
Mutation | Position | Effect | References | |
---|---|---|---|---|
Nucleotide | Amino Acid | |||
c.C148T | R50X | N-terminus | [26] | |
c.151_155delAGAAA | R51PfsX115 | N-terminus | [27] | |
c.T220C | C74R | N-terminus | [27] | |
c.C244T | R82X | N-terminus | [26][27] | |
c.466_469delinsGTAGGGGTGCT CCACCCCGTAGGGGTGCTCCACC |
S156VdelPinsGVKHOVGVLH | D1S2-3 | [26][28][29] | |
Splicing | Intron 4 | [26] | ||
c.T685C | S229P | D1S4-5 | [27] | |
c.G781A | G261R | D1-pore | [27] | |
c.G832T | E278X | D1-pore | [19][30] | |
c.904insG | R302AfsX314 | D1-pore | [28] | |
c.951_953delCTT | F318del | D1-pore | [26] | |
c.G1106A | G369D | D1S6 | Activates ~20mV more negative than wild-type, increases time to peak current and decreases inactivation, increased Ca2+ permeability. | [22][24][26][27][31] |
c.1218delC | W407GfsX443 | D1-2 | [23][26][30] | |
c.C1315T | Q439X | D1-2 | [27] | |
c.G1556A | R519Q | D1-2 | Decreased expression | [22][32] |
c.C1873T | R625X | D2S4 | [26][27] | |
c.G2021A | G674D | D2S5 | [24][26][28] | |
c.C2071T | R691X | D2-pore | [20] | |
c.T2258G | F753C | D2S6 | [27] | |
c.T2267C | I756T | D2S6 | Activates ~35mV more negative than wild-type, inactivates more slowly | [33] |
Splicing | Intron 19 | [27] | ||
c.T2579C | L860P | D2-3 | [27] | |
c.C2683T | R895X | D3S1-2 | [19][20][23][26] | |
Splicing | Intron 22 | [27][28] | ||
Splicing | Intron 22 | [27] | ||
c.C2783A | A928D | D3S2-3 | [24][26] | |
c.C2905T | R969X | D3S4 | [22][27] | |
c.C2914T | R972X | D3S4 | [30] | |
Splicing | Intron24 | [26] | ||
c.C2932T | R978X | D3S4 | [28] | |
c.3006_3008delCAT | I1003del | D3S4-5 | [26] | |
c.G3052A | G1018R | D3S5 | [27] | |
c.3125delG | G1042AfsX1076 | D3-pore | [26] | |
c.3166insC | L1056PfsX1066 | D3-pore | [22][23][26][27] | |
c.C3178T | R1060W | D3-pore | [22][27] | |
c.T3236C | L1079P | D3-pore | Does not open without BayK, activates ~5mV more negative than wild-type | [27][31] |
c.3672delC | L1225SfsX1266 | D4S2 | [23][26] | |
c.3691_3702del | G1231_T1234del | D4S2 | [22][27] | |
c.G3794T | S1265I | D4S3 | [20] | |
c.C3886A | R1296S | D4S4 | [20] | |
c.C3895T | R1299X | D4S4 | [23][26][27] | |
Splicing | Intron 32 | [27] | ||
c.C4075T | Q1359X | D4-pore | [22][27] | |
c.T4124A | L1375H | D4-pore | Decreased expression | [22][27][32] |
Splicing | Intron 35 | [27] | ||
c.G4353A | W1451X | C-terminus | Non-functional | [23][24][26][31] |
c.T4495C | C1499R | C-terminus | [27] | |
c.C4499G | P1500R | C-terminus | [27] | |
c.T4523C | L1508P | C-terminus | [27] | |
Splicing | intron 40 | [26] | ||
c.4581delC | F1528LfsX1535 | C-terminus | [34] | |
c.A4804T | K1602X | C-terminus | [22][27] | |
c.C5479T | R1827X | C-terminus | [27] | |
c.5663delG | S1888TfsX1931 | C-terminus | [26] | |
c.G5789A | R1930H | C-terminus | [20] |
Diagnosis
This section is empty. You can help by adding to it. (June 2022) |
Footnotes
- PMID 24167615.
- S2CID 220500585.
- PMID 31578364.
- ^ "Appaloosa Panel 2 | Veterinary Genetics Laboratory". vgl.ucdavis.edu. Retrieved 11 October 2022.
- ^ "Congenital Stationary Night Blindness (CSNB2) in Tennessee Walking Horses | Veterinary Genetics Laboratory". vgl.ucdavis.edu. Retrieved 11 October 2022.
- PMID 9529339.
- ^ S2CID 45696921.
- S2CID 16309488.
- PMID 25172948.
- PMID 18191655.
- S2CID 41860711.
- S2CID 4311079.
- ^ N. al-Jandal, G.J. Farrar, A.S. Kiang, M.M. Humphries, N. Bannon, J.B. Findlay, P. Humphries and P.F. Kenna Hum. Mutat. 13 (1999), pp. 75–81.
- S2CID 7682929.
- PMID 7846071.
- ^ S2CID 10223880.
- ^ S2CID 42428370.
- PMID 12506099.
- ^ S2CID 13143864.
- ^ PMID 15761389.
- ^ PMID 16670814.
- ^ S2CID 34467174.
- ^ S2CID 42480901.
- ^ PMID 14973233.
- PMID 16155113.
- ^ S2CID 2844173.
- ^ PMID 12111638.
- ^ PMID 11381068.
- PMID 12860808.
- ^ PMID 14609846.
- ^ PMID 15634789.
- ^ S2CID 25987619.
- PMID 15897456.
- PMID 12719097.