DNA nanoball sequencing

DNA nanoball sequencing is a

Adapter DNA sequences must be attached to the unknown DNA fragment so that DNA segments with known sequences flank the unknown DNA. In the first round of adapter ligation, right (Ad153_right) and left (Ad153_left) adapters are attached to the right and left flanks of the fragmented DNA, and the DNA is amplified by PCR. A splint oligo then hybridizes to the ends of the fragments which are ligated to form a circle. An exonuclease is added to remove all remaining linear single-stranded and double-stranded DNA products. The result is a completed circular DNA template.^[2]

Rolling circle replication

Once a single-stranded circular DNA template is created, containing sample DNA that is ligated to two unique adapter sequences has been generated, the full sequence is amplified into a long string of DNA. This is accomplished by

DNA nanoball patterned array

To obtain DNA sequence, the DNA nanoballs are attached to a patterned array flow cell. The flow cell is a silicon wafer coated with

The data generated from the DNA nanoballs is formatted as standard FASTQ formatted files with contiguous bases (no gaps). These files can be used in any data analysis pipeline that is configured to read single-end or paired-end FASTQ files.

For example:

Read 1, from a 100bp paired end run from^[12]

 @CL100011513L1C001R013_126365/1
 CTAGGCAACTATAGGTCTCAGTTAAGTCAAATAAAATTCACATCAAATTTTTACTCCCACCATCCCAACACTTTCCTGCCTGGCATATGCCGTGTCTGCC
 +
 FFFFFFFFFFFGFGFFFFFF;FFFFFFFGFGFGFFFFFF;FFFFGFGFGFFEFFFFFEDGFDFF@FCFGFGCFFFFFEFFEGDFDFFFFFGDAFFEFGFF

Corresponding Read 2:

 @CL100011513L1C001R013_126365/2
 TGTCTACCATATTCTACATTCCACACTCGGTGAGGGAAGGTAGGCACATAAAGCAATGGCAGTACGGTGTAATACATGCTAATGTAGAGTAAGCACTCAG
 +
 3E9E<ADEBB:D>E?FD<<@EFE>>ECEF5CE:B6E:CEE?6B>B+@??31/FD:0?@:E9<3FE2/A:/8>9CB&=E<7:-+>;29:7+/5D9)?5F/:

Informatics Tips

Reference Genome Alignment

Default parameters for the popular aligners are sufficient.

Read Names

In the FASTQ file created by BGI/MGI sequencers using DNA nanoballs on a patterned array flowcell, the read names look like this:

BGISEQ-500: CL100025298L1C002R050_244547

MGISEQ-2000: V100006430L1C001R018613883

Read names can be parsed to extract three variables describing the physical location of the read on the patterned array: (1) tile/region, (2) x coordinate, and (3) y coordinate. Note that, due to the order of these variables, these read names cannot be natively parsed by Picard MarkDuplicates in order to identify optical duplicates. However, as there are none on this platform, this poses no problem to Picard-based data analysis.

Duplicates

Because DNA nanoballs remain confined their spots on the patterned array there are no optical duplicates to contend with during bioinformatics analysis of sequencing reads. It is suggested to run Picard MarkDuplicates as follows:

java -jar picard.jar MarkDuplicates I=input.bam O=marked_duplicates.bam M=marked_dup_metrics.txt READ_NAME_REGEX=null

A test with Picard-friendly, reformatted read names demonstrates the absence of this class of duplicate read:

The single read marked as an optical duplicate is most assuredly artefactual. In any case, the effect on the estimated library size is negligible.

Advantages

DNA nanoball sequencing technology offers some advantages over other sequencing platforms. One advantage is the eradication of optical duplicates. DNA nanoballs remain in place on the patterned array and do not interfere with neighboring nanoballs.

Another advantage of DNA nanoball sequencing include the use of high-fidelity Phi 29 DNA polymerase^[10] to ensure accurate amplification of the circular template, several hundred copies of the circular template compacted into a small area resulting in an intense signal, and attachment of the fluorophore to the probe at a long distance from the ligation point results in improved ligation.^[2]

Disadvantages

The main disadvantage of DNA nanoball sequencing is the short read length of the DNA sequences obtained with this method.