lacUV5
The lacUV5 promoter is a mutated promoter from the Escherichia coli lac operon which is used in molecular biology to drive gene expression on a plasmid. lacUV5 is very similar to the classical lac promoter, containing just 2 base pair mutations in the -10 hexamer region, compared to the lac promoter.[1] LacUV5 is among the most commonly used promoters in molecular biology because it requires no additional activators and it drives high levels of gene expression.[2]
The lacUV5 promoter sequence conforms more closely to the
The lacUV5 mutation was first identified in 1970 in a study of lac promoter mutants that produce higher yields. Some of them, including UV5, has lost catabolite repression at the CAP site.[4] Development into cloning vectors is known since 1982, when a UV5-carrying phage known as "λ h80 lacUV5 cI857" has its genome spliced with the HaeIII restriction enzyme to make plasmids carrying the fragment with UV5.[5]
Sequence
Modern lacUV5 is seen in the BL21(DE3) strain, which carries both a lac operon with the standard promoter and a lacUV5 operon split by the DE3 prophage (and as a result driving the T7 RNA polymerase instead).[1] The two important mutations are underlined.
lacUV5 TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATAATGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT[6] LacZ TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGAAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT[7] position ^-35 ^-10 ^+1
References
- ^ PMID 3537305.
- ^ PMID 10713082.
- PMID 765476.
- PMID 4913210.
- PMID 6292048.
- ^ "Escherichia coli strain BLR(DE3) chromosome, complete genome". GenBank. 2017-04-13. Retrieved 21 April 2019.
- ^ "Escherichia coli strain BLR(DE3) chromosome, LacZ". GenBank. Retrieved 21 April 2019.
 | This genetics article is a stub. You can help Wikipedia by expanding it. |