Wikipedia talk:WikiProject Molecular Biology/Molecular and Cell Biology/Archive 3

This is an current talk page .

Could someone please have a look at the requested move of Gene synthesis → Synthetic DNA (see

Commented ; further input is welcome. --Cyclopia^talk 13:50, 25 May 2010 (UTC)

Help needed. An anon has deleted 90% of this article, along with most of the references, the marked the rest for deletion. The article has plenty of problems but WAS sourced beyond the initiator's papers. I'm just a page-watcher on this tho I did try to clarify and wikify a little a few months ago. Please see article discussion pageI'll revert the hatchet job but I don't have the time, journal access, or expertise to broaden the article.Dankarl (talk) 22:22, 27 May 2010 (UTC)

The same thing has happened to Pseudo amino acid composition, both articles being created by the same author. I'll see what I can do, but it might be appropriate to either merge or broaden each article. Antony-22 (talk) 22:52, 27 May 2010 (UTC)

Hi, I'm not sure what the policy on pages for genes and their protein products is, but there seems to be a page each dedicated to

Hi, I have created some time ago some lists about restriction enzyme cutting sites:

• The main article that drives you to the lists: List of restriction enzyme cutting sites
• The lists:
  • List of restriction enzyme cutting sites: A
  • List of restriction enzyme cutting sites: Ba-Bc
  •  ... etc

I don't know if it would be useful to add these pages to this WikiProject. What should I do? Just to add the banner? anything else?

The first article (List of restriction enzyme cutting sites: A) is completed, with the most available higher impact references added, and 8-10 isoschizomers/enzyme added too. I am working in the rest ones, day by day. Flakinho (talk) 14:28, 28 May 2010 (UTC)

Wow - that's an impressive amount of work done there. Considering the amount of effort necessary to compile these pages, do you think that they'll be able to compete in utility with (or fill a different niche than) similar resources provided by (for example) NEB [1][2][3]? – ClockworkSoul 17:17, 28 May 2010 (UTC)

Agree. I am a strong inclusionist, yet I don't know if this kind of articles really belong here. That said, I appreciate a lot the great work! --Cyclopia^talk 19:20, 28 May 2010 (UTC)

Thank you for your assessments guys, I really appreciate that. Some time ago, I realized that this kind of information (restriction sites and anything) was almost in "private hands", like NEB. Even the REBASE database is hosted on the NEB webpage. So, I thought: it should be free and public, it should be in Wikipedia. Really, I am doing an effort to finish including references and isoschizomers, but it takes long time. I am using the information of REBASE (http://rebase.neb.com/) to check isoschizomers and references. I think this webpage is the most comprehensive DB about restriction enzymes I have ever seen. What should I do to include this articles in the your Wikiproject? Just to add the banner? Anything else? Thank you very much for your fast reply. Flakinho (talk) 19:39, 28 May 2010 (UTC)

Ok, I should include {{Wikiproject MCB}} in the talk pages but, who rates the importance and class of the articles? Flakinho (talk) 19:46, 28 May 2010 (UTC)

Don't get me wrong: I'm not opposed to it in any way... just be sure you know what you're getting into! To answer your question about the MCB template: "list" would be most appropriate I think. As for importance... that can be a little fuzzy sometimes. I can imagine this becoming a resource that people start to use (I know I would: I'm buried in a mutagenesis project right now), so I don't think that "mid" would be entirely inappropriate. – ClockworkSoul 20:33, 28 May 2010 (UTC)

Don't worry, I understood right. I will do it as you said. Good luck with your mutagenesis project. Flakinho (talk) 20:44, 28 May 2010 (UTC)

A quirky thing in wikipedia is that despite the

WP:barnstar. (forgot to sign... --Squidonius (talk

) 23:34, 29 May 2010 (UTC)

what are the four things connected when a protein is formed in translation? —Preceding unsigned comment added by 97.89.161.119 (talk) 02:05, 2 June 2010 (UTC)

Is that a question for school homework? As you probably know the point of homework is understanding and not getting a good mark for good answers which translate into pocket money, so please read Introduction to genetics. Anyway, The essential components in translation are

• mRNA, acts as a instruction manual
• ribosome, acts as a jig to keep the pieces together
• tRNAs, act as a decoding mask to translate codons into amino acids
• and of course.. the new protein! --Squidonius (talk) 04:01, 2 June 2010 (UTC)

Crizotinib

The new-ish Wikipedian ScienceRulz2012 (talk · contribs) has created the article Crizotinib, and asked for my help in developing it.

I think it is within the remit of this project group, so I added the project on the talk page, with an initial assessment of start class/low priority.[4]

I would be very grateful if anyone could look at the article, possibly change the assessment, and make comments on the talk page. Best,  Chzz  ►  16:28, 10 June 2010 (UTC)

The article on Major urinary proteins is at FAC here. This is probably the most relevant community for the article, so I figured I'd let folks know it's up for review. Emw (talk) 00:06, 11 June 2010 (UTC)

See eukaryotic gene example. Surely an arbitrary example is not an appropriate topic for an article? Should this be edited and moved to eukaryotic gene or merged somewhere or.. ? mgiganteus1 (talk) 01:07, 9 June 2010 (UTC)

I agree, it should be merged.

David D. (Talk)

01:13, 9 June 2010 (UTC)

I agree. It currently reads like a tutorial for a course rather than an article. The topic is I also agree not right for Wikipedia. I think that the figures might be useful, but I can't see too much in the textual content that would be useful to merge. Alexbateman (talk) 08:02, 9 June 2010 (UTC)

So what do we do with it? mgiganteus1 (talk) 02:30, 29 June 2010 (UTC)

To be honest, it seems to me that it focuses on the undergrad awe at discovering the fact that anyone can get protein sequences from home (I used to be amused that you could find Ebola genes in NCBI), but has not yet discovered PyMol etc. Hence I would vote delete, but something that strikes me is that oddly it has 10-30 viewers a day, even last year and some pages link to it, such as exon and intron (which are really poor). (why and how do people get there?) I cannot really think what it should look like if the article were to be saved. The only caveat for deletion I can say is that it was created for a reason either to fill a gap a user felt (=call to improve linked articles) or by the user to do something useful with his/her homework, the fact it get viewers makes me think the former may be the case, which means there are many lost people out there. However, being forced to improve articles is not fun so I am not sure how to solve this. --Squidonius (talk) 20:07, 29 June 2010 (UTC)

The FAC nomination for Homologous recombination has been up for about a week and a half, and is in need of further review. As it is a major mechanism of DNA repair and genetic diversification, the subject is one of WikiProject MCB's "High Importance" articles. I'd greatly appreciate any input! Emw (talk) 00:49, 24 June 2010 (UTC)

I noticed that the term non-allelic homologous recombination (NAHR) is one that occurs a lot in the literature but doesn't appear to be represented in the article. Alexbateman (talk) 16:31, 24 June 2010 (UTC)

• HIBADH
• 3-hydroxyisobutyrate dehydrogenase

Science isn't my area which is why I'm not inclined to do anything about this myself but it seems to me that these two articles are pretty much identical and that one should be turned into a redirect for the other. --*Kat* (talk) 14:38, 12 July 2010 (UTC)

• • Yep. I completely agree. Is there someone familiar with this area of research who can do the merge? - Richard Cavell (talk) 10:46, 16 July 2010 (UTC)
    •  Done (see
      talk
      ) 21:32, 16 July 2010 (UTC)
      • thanks! --*Kat* (talk) 09:11, 17 July 2010 (UTC)

I have, again, been doing some major tidying of microscopy related articles, particularly microscope, optical microscope and some smaller edits on digital microscope, USB microscope, stereo microscope, and immunofluorescence. I have been trying to remove strong biases in the articles (most had a bias towards very old and very new technology) and split pages into more logical chunks (for example stereo microscope is now a standalone article). I would greatly appreciate it if anyone could take a quick look at my changes and let me know about any big mistakes or omissions!

I am also trying to create some good example pictures of light microscopy illumination techniques, what do you think of these?

• Four examples of transilumination techniques used to generate contrast in a sample of tissue paper. 1.559 μm/pixel.
• 
  Bright field illumination, sample contrast comes from absorbance of light in the sample.
• 
  Cross-polarized light illumination, sample contrast comes from rotation of polarized light through the sample.
• 
  Dark field illumination, sample contrast comes from light scattered

  by the sample.
• 
  Phase contrast illumination, sample contrast comes from interference

  of different path lengths of light through the sample.

- Zephyris _Talk 08:55, 13 July 2010 (UTC)

Hi, everyone. I'm proposing to recategorise all hormones. My idea is to make the subcategories more distinct from each other, and to give more options to someone searching through the categories. Looking for input! - Richard Cavell (talk) 02:07, 16 July 2010 (UTC)

I recently took some nice DIC microscopy images (or I believe them to be nice anyway) that I took at an internship and I own all the rights to the images...those that I have uploaded have been licenced anyhow. I took a lot of movies which showed vesicles moving about, a cell capturing two gold nanorods and internalizing them, cells thickening and thinning, intercellular connection formation and destruction and also just aesthetically pleasing images? Someone tell me where I could put them or where they might be useful. I particularly like a set of images which showed the fine focal plane precision of DIC (cells visible and in focus in all of the images, but cytoneme and filopodia-like connections disappeared and appeared depending on their focal plane). John Riemann Soong (talk) 01:43, 19 August 2010 (UTC)

are you sure you own the copyright to it? --CarTick 01:50, 19 August 2010 (UTC)

I'm fairly sure. I made all the observations. I took the images. I ran the project. I analysed all the data. They let me do with the images as I like. They even know I uploaded the images to wiki. The equipment was Department of Energy property so in any case they're good! John Riemann Soong (talk) 01:56, 19 August 2010 (UTC)

Dear MCBers, I have two quick announcements regarding the

Second, Ben Good and I will be presenting on our efforts in a webinar next week (Oct 6, 10AM Pacific) for the NCBO. Anyone is welcome to join in to listen what we’ve been up to. And of course, profuse acknowledgments always go out to the editors who really make the Gene Wiki project successful. Cheers,

Fantastic! I am delighted that your proposal was funded and look forward to the improvements in the Gene Wiki that this grant will make possible. The goals of updating the Gene Wiki, increasing trust, and mining the data are all very important and will help to maintain the momentum of the project. 10,000 down, 10,000 to go!  ;-) Cheers. Boghog (talk) 16:45, 2 October 2010 (UTC)

That is cool. Congratulations! --Paul (talk) 19:33, 2 October 2010 (UTC)

Hello,
Could someone take a look at Polycentric chromosome? It's a new stub. I suspect, from a quick google search, that the original editor may have the wrong end of the stick and the definition could well be incorrect. I'm also not sure whether the subject warrants an entire article or whether it would be best off merged with Chromosome or maybe Chromosome abnormality. Ka Faraq Gatri (talk) 22:37, 11 October 2010 (UTC)

A disagreement on whether it is appropriate to mention the "God Gene" in the Vesicular monoamine transporter 2 article has developed. I would appreciate input from third parties. Thanks. Boghog (talk) 04:18, 18 October 2010 (UTC)

There are three outstanding "expert assistance" requests related to MCB on the list:

• Gluten exorphin
• Herpes labialis
• Melanin

{{

• S9 fraction (AfD discussion)

Please contribute to the discussion. Uncle G (talk) 23:05, 18 October 2010 (UTC)

Could someone with some knowledge of the field check over

I would advise blocking the user as all the edits seem to be related to the work of Kuo-Chen Chou, which are in fact a subset of the field of amino acid composition, which includes papers which may be more relevant to wikipedia that analysis tools, such as amino acid differences across species & cog homologues by Pasamontes, the 1940s early ester method, amino acid composition & thermophilic adaptation and so forth. --Squidonius (talk) 22:20, 22 October 2010 (UTC)

The user in question has been warned a number of times about excessive self citation (see

WP:UNDUE. Boghog (talk

) 06:11, 23 October 2010 (UTC)

• Substituted phenethylamines (AfD discussion
  )

Please contribute to the discussion. Uncle G (talk) 01:54, 29 October 2010 (UTC)

Our

Most dictionary definitions refer to antibiotics as substances that inhibit the growth of or kill microorganisms. The definition of microorganism includes protozoa, algae, fungi, etc. in addition to bacteria. Hence it would appear that antibiotics are synonymous with antimicrobials. Boghog (talk) 19:08, 29 October 2010 (UTC)

Ok, thanks for that. Could an even broader definition be any compound which mediates

anthropocentric viewpoint. Smartse (talk

) 20:05, 29 October 2010 (UTC)

IUPAC definition are generally great but this is odd link: a natural or derivative compound produced by some organism which at low doses can kill other forms of life, often nasty ones. So accordingly, Strychnine (made by some tree and kills humans) is an antibiotic and so are natural antivirals (if they exist), but antimicrobial NCE generated by combinatorial chemistry are not (EMEA/FDA approval appart): which is hard to swallow. At least, alcohol produced by yeast (= not an antibiotic due to low potency (but is used as a disinfectant)) nor is azide (synthetic (not an antibiotic) and kills all (= biocide)) are not. In common use the term "antibiotic compound" means a medical drug, despite the etymology (this mismatch is not too uncommon, eg. solvatochromic fluorophores change spectral emissions and not colour in solvents), so do ecologists use the word antibiotic? do medics call a not-yet/not approved antimicrobial drug an antibiotic? If no to both, I'd say antibiotic compound=medical drug, despite liking the non-anthropogenic cause more. --Squidonius (talk) 00:59, 30 October 2010 (UTC)

"do ecologists use the word antibiotic?" they certainly do:

WP:COMMONNAME, and based on what I've said above, antibiotic has a much wider usage than antibacterial, so shouldn't necessarily redirect to antibacterial without any explanation. SmartSE (talk

) 11:28, 30 October 2010 (UTC)

This graph shows the number of edits in the four WP:MCB talk pages, it would be great if it were actually of articles in WP:MCB but that would take more time to do, but I'd assume that the traffic on the WP reflects it's articles (unless everyone is more efficient). Note: The graph has been subjected to SMA-5.
Basically, WP:MCB's hayday was in 2006 when Help and Announcements were split from Discussion and up to last year it was gathering strength, with a nasty dip between Sept-Dec 08, but now it is drammatically loosing edits. Two situations:

• The work is done: molecular biology on wikipedia is a perfect expression system with no leaky expression and 100% knowledge transformation efficiency!
• User apathy. I probably fall into this category as I have been editing many completely recreational other stuff.

I am aware there a similar WP-wide effect, but not sure if it is this pronounced. If it is the latter, what can be done? The only thing I can think of is to make it more rewarding for editors and making a MCB barnstar and encorage its use, maybe? (when I give them out I give the bio one but I do not think it is quite the right one) --Squidonius (talk) 21:49, 20 September 2010 (UTC)

Interesting graph. I suspect measuring the number of good and featured WP:MCB articles promoted per month over the last 4 or 5 years would show similar patterns of activity. While I suppose it probably wouldn't hurt, unfortunately I don't think barnstars will make a significant positive impact on MCB editor activity. In my opinion recommendations from the recently concluded Strategic Planning drive like http://strategy.wikimedia.org/wiki/Task_force/Recommendations/Community_health_1 offer some promising ideas for increasing editor activity in content generation (i.e., producing and expanding articles) and retaining core content contributors. At the recent Wikiconf NYC, Sue Gardner discussed how the WMF plans to enact procedures along the lines of those recommendations, which bodes well. Emw (talk) 23:17, 20 September 2010 (UTC)

Good work on the graph. My feeling is that there is plenty of editing going on for articles. But most of the major issues for the project are somewhat sorted out. That means I can work on the content without bringing suggestions to this discussion page. Alexbateman (talk) 09:49, 21 September 2010 (UTC)

I guess we have become somewhat

gnomish

. There are still some of us lurking around in the dark corners quietly improving articles ;-)

• Albeit it will not make much of a difference as Emw mentioned, it does not hurt either, so using images I had previously I made a barnstar... I was not sure if to use images of double helix/vectors and protein or tools of the trade. How about this:
  

		The Molecular Biology Star
		Not the most valuable award, but some recognition is better than none!

--Squidonius (talk) 20:46, 22 September 2010 (UTC)

To verify the hypothesis that all the edits go on the background, aka the gnome hypothesis :) , I wrote a script to download and analyse all the MCB pages.

The decrease is quite marginal (the data is unmodified, while the black line is a 12-month period moving average (e.i. smoothed out version), whereas the previous graph had relative few edits per month so more noisy so was smoothed), so here is a more succinct pictograph (why a pictograph? It makes the data look more believable in the popular press!), showing there is a 15% drop from last year. I am talking about an absolute difference of 30k edits so any stats will give infinitesimal p-values.

. So there are less edits, but it is not as drammatic as first predicted and it started actually last year... Shame, I quite liked the Gnome hypothesis. The data shows some periodicity, when I have more time I'll do a Furrier analysis to see if it has to do with Northern hemisphere university term times. However, I think there is the Bot hypothesis, in which bots have done most edits, although I have had trouble automatically filtering out bot edits (upto a 3 fold underestimate), which account for over 1/7th of all edits... Parenthetically, edits and editors, as expected, form a power law distribution with a kink caused by bots.

--Squidonius (talk) 21:13, 3 October 2010 (UTC)

I spotted the error in the filtering (I was checking for the "(bot)" tag in the description whereas all the bots seem to finish in -bot, having fixed that, here is the monthly graph split into bots, humans and "gods", the dozen or some editors who have done over 10k edits, although some of these may be bots in disguise.

The decrease is caused mostly by bots: Bot edits have dropped by 65% from last year (October-Dec 2010 corrected) and 75% from 2008, whereas human edits have dropped by 5% per annum since 2010 (gods dropped by 45%), so not so dire after all, but still not good. (apropos, I think I'll bring this analysis somewhere else and stop spamming.) --Squidonius (talk) 08:11, 4 October 2010 (UTC)

"human edits have dropped by 5% per annum since 2010" -- I hope you mean 2008. I don't think this is too bad actually. All the low hanging fruit have been plucked and now the hard articles are left to expand. As long as our long-tail ninjas keep dropping in and adding their improvements and we keep plodding along, then WP-MCB is still a great place for the bio-interested people. --Paul (talk) 10:25, 4 October 2010 (UTC)

This is useful data. Squidonious, did your analysis control for reversions? Edits that simply revert vandalism seem like they would be easily identifiable (by adding probably a dozen-or-so regular expressions to match the most common edit summaries in reverts) and a major source of noise. It would also be good to exclude "minor" edits, which are detectable by parsing out bold m strings from edit summaries. I estimate that over 50% of human MCB edits are reverts or marked as minor or both.

The class of edits I think is the most relevant to the health of MCB and Wikipedia as a whole is that which adds quality to articles: adding at least several sentences of prose, adding in-line citations, adding infoboxes, etc -- not the class that includes reverts and minor edits. This additive class of edits could be (naively?) detected by taking only edits that are not reverts, minor, or bot-made and that add a significant number of bytes (>100?) to the article.

Also, who are those high-activity editors in your "god" category? If they only number about a dozen, it should be trivial to determine if they are bots or core MCB editors. Emw (talk) 12:13, 4 October 2010 (UTC)

All this

navel gazing is going to skew the statistics! Kidding aside, great job Emw and Squidonius in compiling these statistics. My interpretation is there has been a decline in the edits by humans, but the decline has not been precipitous. Perhaps I am reading too much into the graphs, but the spike in both human and bot edits in 12/2007 corresponds closely to the major expansion in the Gene Wiki. There was a lot of activity during this period in creating these gene articles as well as cross linking them to pre-exisiting MCB articles, adding categories, navboxes, talk page templates, etc. This effort resulted in an enormous number of edits in a short period of time. After this initial flurry of article creation and integration came to an end, the more time consuming task of expanding these articles started. To be sure, there has been a lot of MCB edits not related to the Gene Wiki, but the 12/2007 spike and the slow decline since then may in part be due to Gene Wiki activity. Boghog (talk

) 18:03, 4 October 2010 (UTC)

I should also mention sister projects such as

enzyme}} (10/2007 – 12/2007, User:WillowW), and {{pfam}} that also had initial bursts of activity that has since settled down. Boghog (talk

) 18:16, 4 October 2010 (UTC)

At a glance Squidonius' data makes this project look like a representative microcosm of Wikipedia as a whole. Compare the running average on the Total MCB Monthly edits graph to the total monthly edits graph on page 4 of The Singularity is Not Near: Slowing Growth of Wikipedia (pdf, 1.32 Mb) – the shape is extremely similar. The declining edit rate was widely reported with remarkable pessimism (eg), though I've always thought like Paul above – as the low-hanging fruit is plucked, it becomes harder to contribute, so the edit rate declines. Wikipedia wasn't going to sustain exponential growth indefinitely. The revert rate has also increased over time, but again I think this is to be expected as Wikipedia matures – the higher the average article quality, the less likely that any given edit will improve its quality. (I also wonder whether increased use of Twinkle, Rollback etc made reverts easier to identify.) Adrian J. Hunter^{(talk•contribs)} 03:01, 5 October 2010 (UTC)

I spent an hour today playing around with the data and got some interesting results regarding the periodicity of edits across the day (I was surprised as I though that the Euro/US time zones would cancel each out), week (monday procrastination) and year (dip in the summer), any handwaving ideas and hypotheses welcome. As I do not want to spam, I have made a page on my userpage with the graphs [[5]] and one day I'll get round to finishing it (promise). --Squidonius (talk) 23:34, 1 November 2010 (UTC)

I have managed to get a created article and an expansion on the "Did You Know..." list, namely

I prefer Diberri's tool at [6]. It's more direct. WhatamIdoing (talk) 21:39, 2 November 2010 (UTC)

Hi guys,

It'd be great if you could take a look at Wikipedia:Articles for deletion/Porins and LPS. Ka Faraq Gatri (talk) 12:36, 6 November 2010 (UTC)

Version 0.8 is a collection of Wikipedia articles selected by the Wikipedia 1.0 team for offline release on USB key, DVD and mobile phone. Articles were selected based on their assessed importance and quality, then article versions (revisionIDs) were chosen for trustworthiness (freedom from vandalism) using an adaptation of the WikiTrust algorithm.

We would like to ask you to review the MCB articles and revisionIDs we have chosen. Selected articles are marked with a diamond symbol (♦) to the right of each article, and this symbol links to the selected version of each article. If you believe we have included or excluded articles inappropriately, please contact us at Wikipedia talk:Version 0.8 with the details. You may wish to look at your WikiProject's articles with cleanup tags and try to improve any that need work; if you do, please give us the new revisionID at Wikipedia talk:Version 0.8. We would like to complete this consultation period by midnight UTC on Sunday, November 14th.

We have greatly streamlined the process since the Version 0.7 release, so we aim to have the collection ready for distribution by the end of November, 2010. As a result, we are planning to distribute the collection much more widely, while continuing to work with groups such as One Laptop per Child and Wikipedia for Schools to extend the reach of Wikipedia worldwide. Please help us, with your WikiProject's feedback!

If you have already provided feedback, we deeply appreciate it. For the Wikipedia 1.0 editorial team, SelectionBot 16:34, 6 November 2010 (UTC)

A new user that I am trying to help get acquainted and familiar with Wikipedia has worked on this article and asked me how it looks, if everything is formatted right (like the infobox he added). Would it be possible for someone to take a look at it? Thanks in advance. AaronY (talk) 17:23, 12 November 2010 (UTC)

To clarify its just a stub so it won't take long. AaronY (talk) 17:34, 12 November 2010 (UTC)

The formatting looks absolutely fine. Really nice job.  :) I'd suggest splitting the paragraphs that talk about the details of the two species into two separate articles, one for each species. It leaves the genus article a bit bare but that's not unusual for genus articles on Wikipedia.

My one concern at the moment is actually the detail in the taxobox. I know little to nothing about protists but the taxonomy in this area looks far from settled, which is possibly the reason the article's been lacking a taxobox. My specific worry about this article is the layers of classification between

Paramyxea (so do the references cited in the article (for the most part)). I realise our articles are horribly confused and confusing on this (very few of them match each other or match the navbox). Quite what the official status of Paramyxea as a phylum is I don't know. As I said, I think the field is in flux this paper from 2009 is proposing more taxonomic changes. I'm going to drop a note a Wikipedia:WikiProject Microbiology because this is really their area. I'm happy to move the discussion there or to the Marteilia talkpage if MCB think this is liable to clog their project talk page up too much? Ka Faraq Gatri (talk

) 00:56, 13 November 2010 (UTC)

If it was thought more suitable for each of the 2 species mentioned to be the subject of separate articles, it would be good practice for me to create these. I agree that the taxonomy of the protists is far from settled. Cwmhiraeth (talk) 19:58, 13 November 2010 (UTC)

I just found

I have not heard of the term before either. The hammerhead ribozyme article is a bit of a mess. Hence I think it would be better to add this to the ribozyme article as part of an application section, since ribozymes with motifs other than hammerhead also have potential therapeutic applications. I went ahead and created a Ribozyme#Applications section and linked gene shears to it. If you think it is better placed in the hammerhead ribozyme, I would not object if you moved it. Finally it appears that the reason why we never head of gene shears is that the field of therapeutic ribozymes never really took off and have largely been overshadowed by RNA interference. Cheers. Boghog (talk) 11:42, 19 November 2010 (UTC)

Thanks for that and for explaining why they aren't well known. That's probably the best place and you're more likely to know than I am. Judging by the nature article there could probably be a whole article on them, but that will do for now. SmartSE (talk) 16:45, 19 November 2010 (UTC)

(Just a courtesy note.) There has been some discussion recently about whether

The article about the bacterium with the genome which was synthesised by the JCVI institute is in Mycoplasma laboratorium, which is a different organism but work of the same group. Should be split? if so, what name should it have? Mycoplasma genitalium JCVI-1.0? Is the name Mycoplasma laboratorium the best choice for the page name? (see discussion) --Squidonius (talk) 21:55, 1 December 2010 (UTC)

There are a number of articles concerning gene/proteins where there is no human ortholog. Some of these articles transclude the {{infobox protein}} template. This is less than ideal since many of the external links are to human databases (e.g., HGNCid and OMIM) whereas others are "hard wired" to human data (e.g., RefSeq and Chromosome). In order to overcome this limitation, I created a new {{infobox nonhuman protein}} template in which the RefSeq and Chromosome link now should work with any species. In addition, two additional parameters, organism and TaxID have been added so that the species may be specified. An example of the template in use may be found in a recently created uterine serpin article. Comments and suggestion for improving the {{infobox nonhuman protein}} template are welcome.

I also wanted to acknowledge new MCB WikiProject member User:Ufpete for the great job he did in creating the uterine serpin article! Boghog (talk) 07:41, 2 December 2010 (UTC)

Hi. This article was tagged as a suspected copyvio; I don't find any evidence to support that, but it looks like a potential content fork of Meiosis. It had been tagged for merger, but no conversation opened on the subject. I went ahead and redirected the article, but I'm hoping to get some review from somebody who can determine if there is valid content to be merged or if it can/should be turned into a stand-alone article. I'd be grateful if somebody with the background for that would take a shot at it. :) --Moonriddengirl ^(talk) 22:55, 21 November 2010 (UTC)

Thanks for dropping us a note. It's almost certainly not a copyvio and I think it's more like a subsection of meiosis rather than a duplication, so I have turned it back in to a stand alone article for now. If you check the

WP:SELFCITE). The article could do with some copyediting to make them less essay like and wikifying to make them look more normal, but otherwise they are ok. SmartSE (talk

) 00:41, 22 November 2010 (UTC)

I agree with

Origin and Function of Meiosis into the Meiosis article makes some sense (see Talk:Meiosis#Merge_discussion for my rationale). I would be interested in hearing what others think. Boghog (talk

) 12:39, 22 November 2010 (UTC)

I couldn't find any published article which the text might come from. Either the article is still not published or it is truly the work of the author Bernstein0275. I am also for merging the article to Meiosis article since its topic already partially overlaps in "Function" part. The "Origin" part might be used for extension of History and Evolution sections in Meiosis. I am not sure if the topic is enough broad to be kept as separate article. The amount of text will decrease during the style conversion from assay to more formal text. --Mashin6 (talk) 02:02, 24 November 2010 (UTC)

I've commented on this at Talk:Meiosis#Merge_discussion. On a somewhat related note, I think Meiosis is one of those MCB articles that should really be improved. It is a top-importance MCB article that averaged about 5,500 views per day in November, and a common subject in high school biology, but it's a 'C' class article with only 8 references. Compare that to other top-importance MCB articles like Genetics or Immune system, which are both featured yet have considerably (1,000 to 2,000) fewer views per day: http://toolserver.org/~emw/wikistats/?p1=Meiosis&p2=Genetics&p3=Immune_system&project1=en&from=11/01/2010&to=11/30/2010&plot=1. Emw (talk) 17:07, 3 December 2010 (UTC)

A request for comment has been made at the above link. Your input is welcome. Boghog (talk) 23:15, 6 December 2010 (UTC)

One focuses on the biology/enzymology, other on the chemistry, of apparently the same actual enzyme-class. Seems ripe for merge/redirect, but which should be the actual article? Is there an MCB naming guideline for enzymes, or anyone have a feel for the "more common" name for this one? DMacks (talk) 14:08, 12 December 2010 (UTC)

I agree that the two articles should be merged. The IUBMB accepted name is "alliin lyase" while "alliinase" is an accepted alternate name. Since alliinase is more concise, my suggestion is to go with alliinase. Boghog (talk) 16:45, 12 December 2010 (UTC)

Merged&redirected. DMacks (talk) 21:16, 2 January 2011 (UTC)

Nice job! Thanks for taking of this. Boghog (talk) 21:51, 3 January 2011 (UTC)

I stumbled upon it while doing cleanup, and it strikes me as something very odd to write.

The "anti-citation" added in the above edit is equivalent to stating a citation is needed. A quick PubMed search gave several review articles that support that metachromatic leukodystrophy is autosomal recessive. I have replaced the anti-citation with a citation to one of these review articles. Cheers. Boghog (talk) 09:04, 31 December 2010 (UTC)

It is a very odd edit that is the opposite of

WP:V. Nowadays we would be using {{citation needed}} as Boghog indicated. JFW | T@lk

09:09, 31 December 2010 (UTC)

Its good to see the article improve! Does someone know how to remove the skype highlighting that has crept in. Its really ugly. Alexbateman (talk) 15:59, 5 January 2011 (UTC)

I am not sure what you mean by skype highlighting. Are you referring to the page number that have been inserted after many of the in-line citations using the {{rp}} template? Boghog (talk) 16:12, 5 January 2011 (UTC)

It's already been reviewed and promoted by Sasata. I gather it may go to FAC eventually though. Regarding the page numbers (I'm sure that's what Alex means) I agree it is rather ugly, I'll leave my suggestion on the talk page. SmartSE (talk) 16:20, 5 January 2011 (UTC)

Fellow WP:MCBers. I've recently been speaking with a (responsible) New York based journalist who is working on a story on the people and motivations behind the biological content on Wikipedia. She is attending the upcoming American Association for the Advancement of Science meeting and was wondering whether any Wikipedians were going. If you are, she would like to meet with you. Leave me a message or email me and I can put you in touch with her. Her request is as follows:

“I’m a journalist with The Scientist magazine and I’m writing an article about the creators of Wikipedia pages on basic biology. I’m planning on attending the AAAS meeting in Washington DC in February 17-21st [8], and am looking to meet up with Wikipedia writers and editors. I’d like to get a group together and get a better sense of the culture of contributors that write and polish these entries. Alternately, if you know of a different upcoming meeting of life science-Wiki-writers/editors on the east coast, let me know.”

Rockpocket 10:18, 14 January 2011 (UTC)

I've removed the diagram on the right from six articles, as its accuracy has been contested. Help from knowledgeable contributors would be appreciated. Please keep discussion consolidated at Talk:Cytotoxic T cell#Misleading Diagram. Adrian J. Hunter^{(talk•contribs)} 13:12, 22 January 2011 (UTC)

Maybe someone at

WP:MED might know more? SmartSE (talk

) 00:42, 28 January 2011 (UTC)

I asked there too – guess I should have noted that here. Adrian J. Hunter^{(talk•contribs)} 05:22, 28 January 2011 (UTC)

Does anybody know the specs of svg files for wikipedia? (version, supported features... etc.) I tried to upload a bit remastered version of the picture I think is more correct but any svg I exported from illustrator was not accepted. Mashin6 (talk) 14:46, 28 January 2011 (UTC)

I don't know anything myself, but are any of the links from Wikipedia:SVG image support helpful? Adrian J. Hunter^{(talk•contribs)} 14:51, 28 January 2011 (UTC)

I don't know about formats, but have used both illustrator + inkscape before and both work ok. I tend to find inkscape easier though. Was the problem to do with text? If so, see this - it's annoying! SmartSE (talk) 15:14, 28 January 2011 (UTC)

Thanks for help. It went through on Wikimedia Commons. Now the new version represents what I think is T cell maturation. Mashin6 (talk) 00:35, 29 January 2011 (UTC)

I've worked a little bit on Mechanism section. I would be grateful if anybody could go through the text and check style, comprehensiveness, grammar... I would like to push it to FA or GA status but biggest problem are missing citations. If you know any article which can be cited there, please do so. Thanks. Mashin6 (talk) 00:30, 28 January 2011 (UTC)

Hello MCB members! I came across the article "

I would appreciate any input on this matter. I am not sure what to do in this situation. --Tea with toast (talk) 22:06, 3 February 2011 (UTC)

There's an RfC at Template talk:Taxobox colour#In light of the luminosity increase. Please share your thoughts there. Bob the WikipediaN ^{(talk • contribs)} 15:53, 7 February 2011 (UTC)

Can someone here who actually knows the field (unlike myself) take a look at Small nucleolar RNA SNORA64/SNORA10 family? I found this entry while working on Great Backlog Drive. Looking as an outsider, it seems odd to me that this one entry, out of all of the small nucleolar RNA articles, has a really unusual name. Is there a good reason for SNORA64 and SNORA10 to be grouped together into the same article? I understand that they are homologous, but it seems like they should still have separate entries. The external links don't help (the Rfam page is mostly just a copy of this WP article, and the snoRNAbase entries both say "Nothing was found." Before I do the cleanup that the page needs, I'd like to confirm whether or not this should actually be a single article, and if this is the correct. Thanks for your expert help! Qwyrxian (talk) 05:50, 5 February 2011 (UTC)

Thanks for your input Qwyrxian. I've fixed the links to snoRNAbase. The reason the article is one entry is because it is derived from the corresponding Rfam entry which groups genes into families of homologous groups. I've added a sequence alignment below of the human ACA10 and ACA64, it's annotated with a predicted consensus secondary structure.

ACA10           GGTCTCTCAGCTCCGCTTAACCACACGGGTCCAGTGTGTGCTTGGCGTGTTTTCAGGGAG
ACA64           -----GTTGGTTGAAAATCGCCCC-CGGCTTTGGCCGTGGCCGCGGGTGAGATTCGGCGC
                      *  * *     *  ** * *** *   *     **   * ***   *  **   
                ........(((((.((((.(((.((((.(((((((....))))))).))))....)))))


ACA10           GCAGAGAAA--GGCTCTCCTAATGCACGACAGACCCGCCCAGAATGGCCTCTCTGTTCCT
ACA64           CCAGAGCCCCCGGGGGCCTCAGCTCACCGCGCGCTGCCCCATG--TGCGGCGGTGAAACC
                 *****     **    *  *   ***  *   *   ****     **  *  **   * 
                )).)))))....(((((((((..(((((((.(((............))))))))))...)


ACA10           AGGAGTGCGACAATT
ACA64           CAGGCCCCGACAGGC
                  *    *****   
                )))))))).......

I hope this illustrates the relationship between the two genes. --Paul (talk) 07:01, 5 February 2011 (UTC)

I was waiting to see if someone else had more input; the problem is that the above doesn't answer my question, because I don't understand. I mean, I understand the general concept that these two are homologous, and thus closely related. What I'm trying to understand is from a Wikipedia perspective, it seems quite odd that this one pair SNR are grouped together into a single Wikipedia article, while this doesn't seem to be true for any of the other SNORA. It seems like this should either be split into two articles, or renamed to cover just one of them, while including information inside about the other two. I'm looking at this from an organizational/editing perspective, rather than a molecular biology perspective, I guess. Qwyrxian (talk) 15:32, 12 February 2011 (UTC)

Here are a few more snoRNA articles that describe either two homologous snoRNAs or the same snoRNA that has two different names: Small_nucleolar_RNA_F1/F2/snoR5a, Small_nucleolar_RNA_psi18S-841/snoR66, Small_nucleolar_RNA_snoR31/Z110/Z27, Small_nucleolar_RNA_snoR639/H1, Small_nucleolar_RNA_snoZ7/snoR77, Small_nucleolar_RNA_Z195/SNORD33_family, Small_nucleolar_SNORD12/SNORD106 and Small nucleolar RNA SNORA62. I think it is good practice to merge articles for orthologous genes. E.g. there is little point to seperate articles for the human, mouse, yeast, E. coli and Haloferax volcanii versions of SSU rRNA. For paralogous genes it is less clear, the function is often related but diverged. For our purposes the articles for the merged paralogous snoRNA articles are useful since they describe a single entry in our database (Rfam). However, whether this is the best approach for Wikipedia is a different question. Personally, I think many of these snoRNA articles are distinctly lacking in notability. Many are derived from a single article (eg. Kiss et al. (2004)).--Paul (talk) 08:31, 13 February 2011 (UTC)

I agree that in the vast majority of cases,

orthologous genes should be covered by a single article since the function of these gene in different species is very similar if not identical. There are a few exceptions where the gene from one species has special significance (see for example bovine serum albumin). Boghog (talk

) 09:28, 13 February 2011 (UTC)

Hi everyone, I think epitope mapping should be divided into T cell epitope mapping and B cell epitope mapping. ---- Annie D. — Preceding unsigned comment added by AnnieDWiki (talk • contribs) 14:16, 13 February 2011 (UTC)

I have a difficulty with the way this entire section has been handled. The people who use Wikipedia aren't just scientists. Housewives and high school students and writers use this as a reference source too. They have no idea what you're talking about when you start right out with the high end information. I'm a computer engineer and writer. I have no training in biology whatsoever. ...even managed to miss high school biology. I came here to get information about triticale. I'm well read and know quite a bit about the subject already. I'm also pretty intelligent. With all that I couldn't manage to get any information out of that page. All the sentences were for those people "in the know". A reference page that can only be used by those people who already know the information is no use to anyone. At least lighten up on the first paragraph. Give us lay people a break! — Preceding unsigned comment added by Sack36 (talk • contribs) 11:13, 30 January 2011 (UTC)

Which article are you referring to? Please provide a link. Thanks. Boghog (talk) 11:37, 30 January 2011 (UTC)

Without wishing to pre-empt Sack36, I'm guessing from a combination of their talk page (they're interested in fanfiction) and the above statement they were referring to Triticale (which was sort-of referenced in Star Trek). The article isn't in the scope of MCB but does contain links in the lead which are within the scope of MCB (eg. colchicine, polyploidy) which could explain how they ended up here. Ka Faraq Gatri (talk) 13:05, 30 January 2011 (UTC)

The reference wasn't fan fiction--although that was where I first heard about it--but nutrition. It wasn't a specific article. This is the second article I've referenced in the last month from this section and both obfuscated the information. (Sack36)deepsack (talk) 19:21, 30 January 2011 (UTC)

OK, so which articles precisely are you finding difficult to understand as they're currently written? Ka Faraq Gatri (talk) 22:06, 30 January 2011 (UTC)

Sigh. I consider this quirk rather extensive but I will give you a list of the articles I looked at most recently:

• Triticale,
• Polyploidy,
• Caryopsis, and
• Antibody.

By the way, I'd like to commend you all for the Quinoa article. Very clear and informative with very little geek speak.deepsack (talk) 13:08, 31 January 2011 (UTC)

Thank you for taking the time to let us know about your concerns. Even when the problems are extensive, it's very helpful to us to have a few concrete examples.

Triticale, Caryopsis, and Quinoa (all about grains) aren't really MCB articles, so I won't comment on them. MCB doesn't really deal with anything that you can see without a microscope.

Polyploidy and Antibody, however, are within MCB's scope.

I thought that Polyploidy's introduction was all right, and the first section was easy. The other sections vary—maybe one paragraph is good, and the next is a bit complicated. Overall, I thought that the majority of paragraphs were okay, but some readers might give up when they hit the first complicated one. Also, the ==Further reading== list is a bit of a link farm. Does my assessment of this article line up more or less with yours? Is there a particular spot that you thought was much better or much worse than the rest?

Skimming through it, I thought that Antibody was well written. It's pretty long, and it covers a lot of territory. People may have trouble keeping track of all the terms, symbols, and abbreviations, but I'm not sure how we can avoid that. What do you think? WhatamIdoing (talk) 02:25, 1 February 2011 (UTC)

Perhaps it's the part of the country/world we're in. I've noticed that people who live in an area dominated by the health industry understand more biological/medical terms than someone who, say, lives in a computer dominated area. I live in a computer dominated area and thus have very little vocabulary here. I didn't understand these or I wouldn't have listed them. Length of an article means nothing to me. If there had been a way to make money reading I would have been a professional. lol deepsack (talk) 05:35, 2 February 2011 (UTC)

That might be the case, but I kind of hope that, say, a reasonably smart teenager in a good high-school biology class could pick up the major points from these articles, and even get some of the details. If they can't, then that's our fault.

So from polyploidy article, did you get the idea that most (e.g., plants and animals) chromosomes have multiple copies, and that pairs of chromosomes are normal (e.g., humans have 23 pairs/46 chromosomes), and multiple pairs is less common?

I'm asking because I need to know just how broken the article is, from the perspective of a normal, non-MCB person; I hope I'm not embarrassing you. WhatamIdoing (talk) 05:54, 2 February 2011 (UTC)

I also think that the

details are included

to be of value to more technical readers.

As WhatamIdoing suggested, if you could indicate how far you got within each of these articles before becoming completely bogged down, that would be helpful. Boghog (talk) 07:04, 2 February 2011 (UTC)

With Antibody, I got lost at the second sentence, "They are typically made of basic structural units—each with two large heavy chains and two small light chains—to form, for example, monomers with one unit, dimers with two units or pentamers with five units".

With Polyploidy, it never says what it is. It begins with where it occurs and by the time I gave up it still hadn't gotten off that subject.deepsack (talk) 22:22, 2 February 2011 (UTC)

Ignoring

Polyploid and changing the first sentence to read "Polyploid is a term which describes cells or organisms which contain more than two paired (homologous) sets of chromosomes." Ka Faraq Gatri (talk

) 00:50, 5 February 2011 (UTC)

Good suggestions concerning the

Polyploid redirect page be deleted so that we can move Polyploidy to Polyploid. Finally I have made some additional changes to the lead so that it is hopefully clearer. How does it look now? Boghog (talk

) 10:16, 5 February 2011 (UTC)

I've performed the move as discussed. For future reference though, admin tools weren't actually needed since

Polyploid only had one edit, prior to the db tag and so can have a page moved over it by anyone. SmartSE (talk

) 15:18, 5 February 2011 (UTC)

Thanks for completing the page move SmartSE. Concerning the

good article. Please take a look at the previous version at the time when it was promoted . I think the lead of that version is somewhat clearer. If so, perhaps we should restore some of the language of the previous version. Boghog (talk

) 15:35, 5 February 2011 (UTC)

I went ahead and edited the lead to the Antibody article so that it is hopefully now clearer. How does it look now? Boghog (talk) 21:16, 10 February 2011 (UTC)

I think that the recent changes to

Polyploid

constitute an improvement. I was a little concerned about the lack of a simple, direct definition at the start. Sack, when you have a few minutes, please let us know what you think.

Could we get a simpler image for the lead? I'm thinking of something that shows a couple of chromosomes in diploid vs a couple of chromosomes in tetraploid. The tree just doesn't illustrate the concept directly enough, and the speciation image shows a specialized issue, rather than the plain old normal state.

Also: Would it be useful to say that in tetraploid, the offspring receives pairs of chromosomes from each parent, to parallel the statement about the singles that are received in diploid organisms? WhatamIdoing (talk) 18:14, 5 February 2011 (UTC)

What about a modified version of this image? Since it was only uploaded last year we might be able to get the original creator to modify it. Ka Faraq Gatri (talk) 18:54, 5 February 2011 (UTC)

I am the creator and would be happy to make an extended version of the image. I'll get it done some time during next week (14–20 February). Ehamberg (talk) 05:08, 10 February 2011 (UTC)

Great! A extended version of your graphic would be perfect for the polyploid and several related articles. Cheers. Boghog (talk) 07:50, 10 February 2011 (UTC)

I made an extended version. It's available here: File:Haploid, diploid ,triploid and tetraploid.svg Ehamberg (talk) —Preceding undated comment added 13:49, 15 February 2011 (UTC).

There's also the Ploidy page to consider, but merging the two pages would be a huge task. Nadiatalent (talk) 19:13, 5 February 2011 (UTC)

I'd like to remove the second image at

Polyploid because it is such a bizarrely unusual example of polyploid speciation, and also from Speciation#Speciation_via_polyploidization. Nadiatalent (talk

) 19:13, 5 February 2011 (UTC)

I support removing the second image. The File:Haploid vs diploid.svg image looks great, but exactly how should this be extended? Triploid or tetraploid or ... ? The author Ehamberg was recently active, so there is a good chance that (s)he can update the image. Boghog (talk) 19:50, 5 February 2011 (UTC)

Re: the File:Haploid vs diploid.svg image. Maybe if the chromosomes were shrunk a little so we could fit two images alongside each other. Perhaps triploid, tetraploid and one other? Caption could read something like "examples of polyploidy"? Ka Faraq Gatri (talk) 23:39, 5 February 2011 (UTC)

Sounds good, but perhaps we should stop at tetraploid to prevent the graphic from becoming too complex. I have contacted Ehamberg to request a new version. Concerning Antibody, I have started a discussion on the articles talk with a suggestion on how to simplify the lead. Boghog (talk) 11:14, 6 February 2011 (UTC)

Thanks, Ehamberg. It looks great. I've added it to the article. WhatamIdoing (talk) 18:05, 15 February 2011 (UTC)

Lovely.  :) Ka Faraq Gatri (talk) 18:57, 15 February 2011 (UTC)

A big improvement. Thanks Ehamberg for creating the new graphic, Ka Faraq Gatri for suggesting it, and WhatamIdoing for adding a caption and inserting it, and Nadiatalent for further copyedit. A real team effort. Boghog (talk) 19:48, 15 February 2011 (UTC)

Yes indeed, a big improvement! I've also removed the image from Speciation because it is so unrepresentative. There are several much more common routes to polyploidy, but I'm rather at a loss to think how to adequately represent them, and inclined to think that it would be a mistake to try, because a diagram would give the impression that all the possibilities are shown.

It is very nice indeed to see real progress in this subject area, thanks to a team effort! Nadiatalent (talk) 22:23, 15 February 2011 (UTC)

Someone familiar with cloning might want to take a look at these articles. There is a merge proposal and some cleanup in tone and referencing is needed. Regards, P. D. Cook ^{Talk to me!} 19:58, 24 February 2011 (UTC)

Since the two article are clearly about the same subject so I went ahead and merged them. I also cleaned up the article a bit, but more work is needed. Boghog (talk) 05:13, 25 February 2011 (UTC)

Hi—another question from the editor entirely ignorant of molbio info. The reason I'm editing these articles is because I'm trying to work on the backlog of pages with Stylistic problems, which a number of snoRNA pages are marked with (usually with {{jargon}}</jargon>). While looking for models to follow, I saw that all of the SNORA articles use at the bottom the navigational template <nowiki>{{Small nucleolar RNA SNORA}}. This template contains not only SNORA snoRNA, but also a variety of others (J, MB, etc.). However, articles other than SNORA articles don't have this template. It seems to me that an article like Small nucleolar RNA J33, which is listed on and linked in {{Small nucleolar RNA SNORA}} should also have that template. Alternatively, it seems like we could remove the non-snoRNA articles from that template. Does that make sense? It's odd to me to see a navigational template that has links to articles that do not themselves use that template. Is there some specific reason for this? Do you believe the template should be added to all of the articles it links to (and, if so, possibly renamed?), or should the other articles be removed from the template.

Thanks again for bearing with a clear non-expert. Qwyrxian (talk) 05:09, 18 February 2011 (UTC)

I don't think anyone would object if you added the template to those pages.--Paul (talk) 09:26, 21 February 2011 (UTC)

I just took a look at the template, and it turns out that "Small nucleolar RNA SNORA" redirects to "Small nucleolar RNA". I'm going to go ahead and add the latter to all of the articles currently linked from the template (it may take me a little while, though). Qwyrxian (talk) 07:05, 2 March 2011 (UTC)

These articles

• Biglycan
• RBBP7
• Sequestosome 1
• RIPK1
• GPHN
• RGS16
• SGCA
• COPG2
• GMEB1
• RPL31
• MAP7
• TRIM63
• COPZ1
• GNA13
• GNA12

Have empty references - the PMID id is there in the ref name (where I've looked)but the content is null - an HTML comment and some markup.

Secondly reading one of the references I found we didn't have an article on amino acid response - so I made a little stub. For reasons I won't go into I think this is a very important area of cell biology - unfortunately my ignorance in this area is somewhat staggering. It would be fantastic if we had a decent article (or set of articles) that lad out the current state of knowledge of the pathways for each deficiency, and from ATF4 onwards.

Many thanks if you are able to help. Rich Farmbrough, 22:48, 2 March 2011 (UTC).

Andreas and I have fixed those refs. I will email the author of the script that generated them. I didn't think to check the "Further reading" lists until the last few I did so some articles will have redundant references.--Paul (talk) 11:09, 3 March 2011 (UTC)

Rich, thanks for pointing the problem. For an unknown reason the reference was removed between two jobs of my robot ( http://en.wikipedia.org/w/index.php?title=RPL31&diff=next&oldid=303699564 ). I'm sorry, I currently don't have the time to find the reason of this problem.--Plindenbaum (talk) 11:27, 3 March 2011 (UTC)

Good to have them fixed. Rich Farmbrough, 00:32, 4 March 2011 (UTC).

I have recently been looking at the referral stats for a number of biological databases to find out how much traffic Wikipedia is generating for them. I contacted the nice people at the RCSB

In this edit, the PDB codes became hidden by default in the Gene Wiki template. Now you have to hit the "show" link next to "Available structures" to get the link to RCSB (see for example

talk

) 18:17, 28 February 2011 (UTC)

That is cool! I think Andrew hit the nail on the head. An analogous change to the {{Infobox protein family}} template was made in this edit. Additional {{PDB}} links that may have been included in-line or in the further reading sections are slowly being deleted since they are already contained in the Gene Wiki and Pfam infoboxes and therefore are redundant. While the number of referrals may be down, those that do find and follow the links are probably more determined and therefore may stay longer. Boghog (talk) 20:04, 28 February 2011 (UTC)

Thanks, that explains a lot. The hidden database IDs result in fewer clicks that go through to PDB... We have a number of widgets and tagging libraries which might serve as an inspiration of how lists of database cross-references could be displayed to the user in a more graphical way. http://www.rcsb.org/pdb/static.do?p=widgets/widgetShowcase.jsp I understand that wikipedia won't be dynamically loading any content from other sites, but I wonder if a better presentation might still be possible within mediawiki... Something else: Seems there is a systematic issue and there are several pages that contain a section labeled "Available PDB structures" but the links don't go to any of the PDB sites, but to PDBsum. I suggest renaming the section to "Links to PDBsum" and adding another section that redirects to the PDB. Examples: Leucine-rich_repeat, Ligand-gated_ion_channel Andreas (Andorsch (talk)) —Preceding undated comment added 22:41, 28 February 2011 (UTC).

For at least

talk

) 00:36, 1 March 2011 (UTC)

There was some disagreement as to which external link was most appropriate (see Template_talk:PDB for the gory details). We left it to the individual contributor to decide which link to include (see for example Hsp90 for an article that contains pfam infoboxes that point to the rcsb). There is another template called {{Infobox enzyme}} that links to PDBSum since it is not clear at least to me how to format a link to the PDB that will produce a list of structures for a given EC number. Andreas, do you if it is possible to construct such a link (for example a link that would produce output equivalent to the advanced search query parameter: Enzyme Classification Search : EC=1.1.1.1)? Boghog (talk) 09:18, 1 March 2011 (UTC)

Thanks for the pointer to that thread. It seems a bit out of date and many things have changed since then. PDB is the primary database and my feeling is that outgoing links should point to it, rather than derived databases. If links go to a secondary site, they should be labeled with the correct database name. At the present you can link via EC numbers to RCSB PDB using this URL http://www.rcsb.org/pdb/search/smartSubquery.do?smartSearchSubtype=EnzymeClassificationQuery&Enzyme_Classification=1.1.1.1 (there prob. will be an alternative and simpler URL available as well soon). Such URLs are available for pretty much each of the advanced queries. Let me know if you have any other PDB related questions. Andreas (Andorsch (talk) 14:44, 1 March 2011 (UTC))

And thank you for the PDB EC link. I have updated the {{Infobox enzyme}} template so the link now points to the RCSB PDB. From the beginning I thought it was better to link to the RCSB PDB and with the recent improvements, I now even more strongly believe that. Again, thanks for your help. Cheers. Boghog (talk) 19:41, 1 March 2011 (UTC)

Awesome... What is needed to get the the text "Available PDB structures" changed to "Links to PDBsum" at {{PDB3}} (or update the link to point to PDB) ? I am happy if article authors have free choice to which external resource they want to link, however PDBsum is not related to PDB and as such the headline over the box should be precise. --Andreas (talk) 02:08, 2 March 2011 (UTC)

It is trivial to change the {{PDB3}} template to point to the RCSB PDB and create a new PDBSum template, but as can be seen from the previous discussion, there were disagreements. As you point out, there have been many enhancements to the RCSB PDB since then (perhaps the most important in the context of the {{Infobox enzyme}} template is that links to UniProt are now included and Pfam and InterPro domain assignments can now be displayed over the sequence graphic) so I think standardizing on RCSB PDB should now be less controversial. I will raise the issue again at the PDB template talk page. Boghog (talk) 07:26, 3 March 2011 (UTC)

Back to the original question by Alex, nothing has changed with links from wikipedia during this time, according to my knowledge. Perhaps the number of people who are using wikipedia decreased during this time, and this is an explanation. We now have several templates with links to different sources of PDB files, which is only convenient. As about links from Pfam template, I would trust the opinion of Alex. What he thinks? Which PDB link would be best from Pfam template? That could be PDB in US, PDBe in Europe (which is definitely better than PDB in US), or PDBsum. I do not have any personal interest here, except that PDBsum is the best for wikipedia users (we had quite a dispute with Boghog about this here).

Hodja Nasreddin (talk

) 03:00, 4 March 2011 (UTC)

Hodja, I see that you have been making strong statements in the past. Just to make sure your opinion is based on the current state of the RCSB PDB (see [1] as well as the releases over the last years) and not on a state it might have been several years ago... --Andreas (talk) 06:58, 4 March 2011 (UTC)

Andreas from the PDB, we are not in a business to increase PDB traffic, but there is a good way to do it: run ProteinBoxBot for every protein currently in PDB and create articles about them. This can be done by using Uniprot summaries about proteins (it has the same copyright conditions as wikipedia). Remember that number of different proteins in the PDB is several times smaller than number of PDB files. Exclude proteins from Structural Genomics projects as not notable. I am sure that PDB staff can easily do it. This is the way to do well for PDB, but still be in agreement with wikipedia policies. The issues abouta Pfam box and PDB3 templates are irrelevant. Thanks,

Hodja Nasreddin (talk

) 23:06, 4 March 2011 (UTC)

My intention is only to get the link corrected that is wrongly attributed as pointing to the PDB. We don't need wikipedia to increase our traffic. Besides this, we are suporters of open access and you can already find content from us on various pages, although not as systematic as you are suggesting. --Andreas (talk) 00:38, 5 March 2011 (UTC)

The thread is about PDB traffic through wikipedia. There is nothing obviously "wrong" in Pfam template. It tells "available PDB structures" (not PDB RSGB site) and directs user to PDB files through the PDBsum site. All these links (PDD, PDBe, PDBsum, etc) are good likns rather than "links to avoid". Hence this is more a matter of personal preference for an editor who creates/modififes a page. Hence we have a number of different templates.

Hodja Nasreddin (talk

) 01:10, 5 March 2011 (UTC)

Links to PDB

Everyone agree that PDB is a great resource. Yes, it was significantly improved. Please add links to PDB anywere, and everyone will be very happy. But no one should replace good links to other sites by links to PDB. This is per

Hodja Nasreddin (talk

) 14:27, 5 March 2011 (UTC)

Please review seriousness v. proposed deletion as parody of new article Names of small numbers at Wikipedia:Articles for deletion/Names of small numbers

Molecular and Cellular Biology WikiProject members, please, this is being discussed at:

Wikipedia:Articles for deletion/Names of small numbers http://en.wikipedia.org/wiki/Wikipedia:Articles_for_deletion/Names_of_small_numbers#Names_of_small_numbers

Thank you. Pandelver (talk) 00:17, 12 March 2011 (UTC)

new article

Escherichia coli (molecular biology)

In wikipedia if bacteria cause a disease they are well documented, otherwise they are a red link.

Escherichia coli (molecular biology), where I have written about the history of K-12 and B strains but have not mentioned molecular cloning, unfortunately I will not have any editing time in the near future, so if anyone wants to add a section please do! --Squidonius (talk

) 13:47, 12 March 2011 (UTC)

Gene mutation question

Over at BRCA2, a mutation "999del5" is identified as truncating the protein. What does the "5" mean here? I know what "999delA" would mean, but I don't think I've seen a number used, and I can't find the answer. WhatamIdoing (talk) 20:32, 17 March 2011 (UTC)

Not 100% sure, but from Am. J.Hum. Genet. 60:1050-1058, 1997, table 2, it appears that 999del5 = 999delTCAAA, meaning starting at nucleotide position 999 of the BRCA2 gene, the five nucleotides "TCAAA" have been deleted producing a frameshift mutation. Boghog (talk) 21:33, 17 March 2011 (UTC)

It was my impression that frameshift shouldn't produce a truncated protein, which is what the article asserts. It should, in theory, produce an equally long protein, with a nonsensical amino acid sequence. (Shouldn't it?) WhatamIdoing (talk) 01:15, 18 March 2011 (UTC)

A frameshift mutation will result in the original stop codon not being read and depending on the sequence, will produce new stop codons that may appear before or after the original stop condon. In the case of the 999del5 mutation in BRCA2, a new stop condon appears before the old one resulting in a truncated protein. Boghog (talk) 06:36, 18 March 2011 (UTC)

Yep. Frameshifts usually result in protein truncation: 3 of the 64 possible nucleotide triplets are read as stop codons, so generally a stop codon will appear shortly downstream of a mutation that causes a frameshift. Adrian J. Hunter^{(talk•contribs)} 12:24, 18 March 2011 (UTC)

Thanks for the explanation. I appreciate it. WhatamIdoing (talk) 05:08, 19 March 2011 (UTC)

dashes

Why are em dashes used on List of EC numbers (EC 2) and many of the templates at the bottom of that page? Sources may use en dashes, but no-one uses an em dash within a word. These shouldn't even be redirects. I thought about moving the em-dash redirects to en dashes, but there are so many of them that I was worried I might gunk things up. Am I missing something? Also, aren't many of these ambiguous with the use of only hyphens? — kwami (talk) 22:50, 18 March 2011 (UTC)

I see that many of the links that used em dashes were redirects to page names without em dashes, so I went ahead and edited the links. It appears that the em dashes are part of the IUBMB accepted name (see EC 2.1.1.3 for example). I also tried to find to find an official IUBMB guidelines concerning the use of dashes, but I cannot find any. I am not certain what is the best course of action is. Rename the articles or eliminate the directs from the category pages. Given the number of enzyme pages, either course of action would be an enormous amount of work. Boghog (talk) 09:24, 19 March 2011 (UTC)

On second thought, it is clear that em dashes in enzyme names are used to separate the names of different reactants in the catalyzed reaction whereas hyphens are used within a chemical name. So to be correct, the enzyme pages should really be renamed to include an em dash if one is used in the IUBMB accepted name. However again would be an significant amount of work and it is probably best that a bot do this. If there is consensus for doing this, I might be willing to bring BogBot out of hibernation to complete this job. Boghog (talk) 09:40, 19 March 2011 (UTC)

I'll be damned! They really do use em dashes. I thought it was just an editor who couldn't tell the difference. Yes, they should be moved to the more precise punctuation. I can do that with AWB. But first, can we verify that that web site has it right? Surely they should say somewhere that's the convention. It really is bizarre to use em dashes rather than en dashes in the middle of names. — kwami (talk) 19:13, 19 March 2011 (UTC)

The link EC 2.1.1.3 is to the International Union of Biochemistry and Molecular Biology (NC-IUBMB), so it doesn't get any more official than this. Hence I certainly believe that the web site is correct. There are 3246 pages that transclude the {{Infobox enzyme}} template so that there are at least that many enzyme articles. Not sure how many have names with em dashes in them however. Probably a relatively small fraction, may be on the order of a few hundred. I think the reason that em dashes are used instead of en dashes is that enzyme names often contain many hyphens (and spaces) and an single en dash may not stand out enough. For the most part, links containing em dashes are redirects to names where the em dash has been replaced by a single hyphen. Boghog (talk) 21:08, 19 March 2011 (UTC)

Yes, I figured that might be the reason. But the number of articles is not convincing in itself: if a typographic mistake were made, it could easily be site-wide. (I've done that myself, typesetting dozens of articles with AWB only to realize that I'd been using a wrong symbol.) I don't have any reason to think that's the case, but it would be nice to verify this verbally. — kwami (talk) 22:13, 19 March 2011 (UTC)

I now have some hard numbers. Based on enzyme.dat (Bairoch A (1993). "The ENZYME data bank". Nucleic Acids Res. 21 (13): 3155–6.

PMID 8332535. {{cite journal}}: Unknown parameter |month= ignored (help)), there are 5268 Enzyme Commission entries (record = "ID"). In this particular file, en/em dashes in the accepted name (record = "DE") are represented by a double hyphen "--". There are 226 entries with a double hyphen (see User:Boghog/Sandbox5 for wiki links, two links per line, left link is based on the enzyme name where the double hyphen has been replaced with a single hyphen, "--" → "-", right link double hyphen has been replaced with an em dash, "--" → "—"). It appears that the articles names have em dashes replaced with hyphens whereas the proper enzyme names containing the em dashes are redirects. In my opinion, the direction of these redirects should be reversed. Boghog (talk

) 10:38, 20 March 2011 (UTC)

I agree with reversing them, of course. My only concern is moving them all and then realizing, oops! wrong dash.

Evidently because of coding problems, in some names brackets have been replaced with parentheses. An example is

(glutamate-ammonia-ligase) adenylyltransferase ~ (glutamate—ammonia-ligase) adenylyltransferase. It would be good to correct those too if we can. I'll see what I can dig up. — kwami (talk

) 20:56, 20 March 2011 (UTC)

Ah, see Wikipedia:Naming_conventions_(technical_restrictions)#Forbidden_characters. Square brackets are not allowed, and the templates that modify a title (such as eBay) do not work for them. We can substitute East Asian brackets, but they won't kern properly: ［glutamate—ammonia-ligase］ adenylyltransferase. — kwami (talk) 21:24, 20 March 2011 (UTC)

I done an extensive google search, and I cannot find any documentation about whether em or en dashes should be use in enzyme names. In looking at other databases, there doesn't seem to be much consistency. For

Thetin-homocysteine S-methyltransferase

:

Database	Link	Symbol
EC number	[9]	— (em dash)
IntEnz	[10]	— (em dash)
BRENDA	[11]	- (hyphen)
ExPASy	[12]	-- (double hyphen)
KEGG	[13]	--- (triple hyphen)

If double and triple hyphens are considered equivalent to en and em dashes respectively, then three four of the databases use em dashes, two one uses en dashes, and one uses hyphens. Since the official IUBMB database uses em dashes, my opinion is the article names should also contain em dashes. Boghog (talk) 21:30, 20 March 2011 (UTC)

Concerning the brackets, I guess we can keep them as is (i.e., use parentheses) and insert {{Correct title}} templates. Boghog (talk) 21:33, 20 March 2011 (UTC)

What would be the 2nd source using en dashes?

Double hyphens are the usual substitute for em dashes, and single hyphens the substitute for en dashes. (Triple hyphens are occasionally for em dashes used when double hyphens are used for en dashes.) So we have no evidence that anyone uses en dashes, while 3 and possibly 4 use em dashes. That's convincing. I'll start moving. — kwami (talk) 21:47, 20 March 2011 (UTC)

I fixed a dozen or so links on your sandbox (parentheses and clipped names). — kwami (talk) 22:03, 20 March 2011 (UTC)

You are right, there is no 2nd source using en dashes. Thanks for starting the move and for fixing the names in my sandbox. Boghog (talk) 05:57, 21 March 2011 (UTC)

Power went out, but I'll restart AWB in a minute. — kwami (talk) 06:15, 21 March 2011 (UTC)

AfD disscussion for Nkx2-2as

• There's an AfD discussion for Wikipedia:Articles for deletion/Nkx2-2as that it would be useful to get input from MCBers on.--Paul (talk) 08:06, 26 March 2011 (UTC)

Original self replicating molecule

Is there somewhere here discussing why (or if) the self replicating molecule only got created once? 82.137.72.133 (talk) 10:51, 31 March 2011 (UTC) Yes, so I went and posted it on the link for queries at the top of the page and it came back herePpeetteerr (talk) 12:31, 4 April 2011 (UTC)

Sub categories for Biological database

Hi,

Plindenbaum and I were editing some pages on Orthology databases. We discussed making a subcategory of Biological databases called something like Orthology databases. Of course one could subclassify the biological database articles more completely. Perhaps using the NAR database collection classification:

http://www.oxfordjournals.org/nar/database/c/

Has this been discussed before? Alexbateman (talk) 08:22, 4 April 2011 (UTC)

Did the self replicating molecule only get created once?

Is there somewhere here about why (or if) the self replicating molecule only got created once? Ppeetteerr (talk) 12:30, 4 April 2011 (UTC)

Is this self replication my answer? (joke)Ppeetteerr (talk) 12:35, 4 April 2011 (UTC)

There is no proof of a "Shadow Biosphere" at present (although the topic has gained ignominy after the badly phrased Arsenic Felisa Wolfe-Simon paper). I am not sure if anyone has delt with the topic, but if a self replicating molecular machine were to arise twice with similar substrates (therefore were in competition), one would have a much higher fitness than the other (IMO), eg. LUCA's forefathers were one more rubbish (low fidelity and high promiscuity) than the other, until there was little fitness difference resulting in a radiance of 3 domains and the hard polytomy of bacterial phyla. There is a paper where they get junk DNA and make a antibiotic resistance gene in 50 cycles and its improvement per cycle follows a rectangular hyperbola. Interesting topic of speculation... --Squidonius (talk) 20:42, 4 April 2011 (UTC)

GeneReviews

A number of editors, both named and anonymous, have been adding external links to

Infobox disease}}, the editors use the external links section. Often, the links are only to very peripherally related conditions. Today it was 205.152.158.201 (talk · contribs

) who did a link adding spree.

Does anyone know why this is happening, and does everyone agree that these links are not always useful? What could we do to streamline these edits? Does anyone know the presumed person who is behind this? JFW | T@lk 17:04, 5 April 2011 (UTC)

I don't think anyone besides the person him/herself knows who this individual is. After some

GNF Protein box}} template at the moment, but perhaps we should add a "disease linkage" section where GeneReviews links could be added. Furthermore we could have a bot go through these pages and move the external links to the infoboxes. Boghog (talk

) 18:33, 5 April 2011 (UTC)

This came up at the external links noticeboard over a year ago, and I believe that the GeneReviews parameters were added to Infobox disease as a direct result. At the time, the editor was being reasonably careful about the links s/he added. So long as that is still more or less true, and any individually unwanted links aren't being edit-warred over, then I don't think we have a problem—except for my conviction that such a person could be a valuable registered editor, and I'd like to convert him from a "links-only" anon to a solid content contributor if at all possible. WhatamIdoing (talk) 19:29, 5 April 2011 (UTC)

I have no intention of chasing away the editor and would love to pin them down and turn them into content generators. JFW | T@lk 21:44, 5 April 2011 (UTC)

Satellite cell (glial)

A new editor has asked for help at

Talk:Satellite cell (glial), then I'm sure she would be grateful. WhatamIdoing (talk

) 19:26, 8 April 2011 (UTC)

Adopt an orphan

Monopolin has been an orphan since the winter of 2009. "Mono" means "lonely" in Greek... Will spring 2011 bring hope? You can make a difference. ^walk victor falk ^talk 11:14, 10 April 2011 (UTC)

Don't pass go and don't collect $2000. JFW | T@lk 15:15, 10 April 2011 (UTC)

Here in NZ, it is autumn... it is raining here so the spring comment is very upsetting :-P --Squidonius (talk) 22:24, 10 April 2011 (UTC)

Peer review on DNA nanotechnology articles

Hi all! I currently have peer reviews running for two articles I have worked on, DNA nanotechnology (review page) and Nucleic acid design (review page). I'd appreciate it if you could take a look and leave any feedback you could give. Thanks! Antony–22 (^talk⁄_contribs) 01:42, 19 April 2011 (UTC)

Jmol

Just a quick pointer that there is an interesting thread over at WikiProject Chemicals about enabling Jmol on wikipedia. This is something that might be interesting for many pages here, too. [14] --Andreas (talk) 04:08, 8 April 2011 (UTC)

On a related note, would anyone mind if I uploaded the PDB to Wikipedia? All the tools were developed here: http://PDBWiki.Org --Dan|^(talk) 13:09, 12 May 2011 (UTC)

BTW, where is the Jmol discussion? --Dan|^(talk) 13:11, 12 May 2011 (UTC)

The discussion was moved to an archive. Concerning uploading the PDB to Commons, this might make sense if and when Jmol is made available. However there are some significant security concerns in doing that. In the short to medium term, a off-site Jmol server might be a more acceptable solution (see for example chemapps) and it would make sense to store the coordinates on that server. Boghog (talk) 16:04, 12 May 2011 (UTC)

GA reviews and peer reviews requested on circadian biology articles

Hi everyone,

My biological clocks class is working on a few circadian biology articles. We've submitted

Candolle (create review page

) at GAN, but so far no reviewers have shown up; if one of you could help with a review, that would be great. We're also tackling the following articles:

• Timeless (gene)
• Melanopsin
• CLOCK
• Pigment dispersing factor
• Period (gene)
• Casein kinase 1
• Colin Pittendrigh
• Ron Konopka
• Jürgen Aschoff
• Jean-Jacques d'Ortous de Mairan
• Joseph Takahashi
• Ignacio Provencio
• Seymour Benzer

We haven't set up formal peer reviews for the latter articles, so the talk pages for the articles are fine for feedback. General feedback for the class can go here or on my talk page. Thanks!

C1ock122 (talk

) 21:17, 19 April 2011 (UTC)

Bleb and motility

Bleb is a (the) member of the non-existent category Category:Cell motility. I'm not sure it belongs there, however I am also inclined to think that would be a useful category. I leave it to the experts. Rich Farmbrough, 23:48, 24 April 2011 (UTC).

The category member is currently Bleb (cell biology), and it seems reasonable. Mikael Häggström (talk) 06:13, 15 May 2011 (UTC)

Is there a manual of style for protein and gene articles?

I wanted to know the consensus for what headers and sections a protein or gene article should have and what are the preferred orders, but both

wp:Manual of style (gene articles) are currently red at this time of posting. They should be made blue, either by redirect or by article creation. Mikael Häggström (talk

) 06:10, 15 May 2011 (UTC)

That would be really good, there is little consistency for non-human protein and there are many basic anabolic enzymes which are missing, such as

3-isopropylmalate dehydrogenase (leuB or IPMDH). --Squidonius (talk

) 06:37, 15 May 2011 (UTC)

Concerning non-human proteins, the {{Infobox protein}} template was used for historical reasons however this is far from optimal since many of the links provided by this infobox are human specific. A new {{Infobox nonhuman protein}} template was created relatively recently that should replace {{Infobox protein}} in articles for proteins without a human ortholog. Missing enzyme articles is of course a separate issue from the MOS. Perhaps a new bot could be commissioned to finish the heroic work started by WillowW (talk · contribs). Boghog (talk) 08:35, 15 May 2011 (UTC)

I also think it would be a good idea. However in the vast majority of cases IMHO, the gene and the protein encoded by that gene should be in the same article, hence I think there should only be one MOS (

wp:Manual of style (gene and protein articles)). I will start working on one. Boghog (talk

) 07:01, 15 May 2011 (UTC)

Great. That manual of style could have subsections for any specific guidelines for gene aspects or protein aspects. Mikael Häggström (talk) 07:07, 15 May 2011 (UTC)

Converting interactions-sections to prose

A major issue that needs a note in any

collection of external links (which Wikipedia should not be). Therefore, I suggest adding the guideline that a protein interaction is notable for inclusion only when there's a comment on any effects of the interaction, such as specific stimulation or inhibition of protein activity, and may otherwise be deleted. The comprehensive lists can still be found in external (and more updated) databases for this purpose, such as CPDB. Mikael Häggström (talk

) 06:55, 15 May 2011 (UTC)

The primary reason for including these internal links (emphasis added) is to reduced the number of orphan

GNF_Protein_box}} template. An additional advantage of this solution is that it would be easier for bots to update these lists. Any particularly notable interactions could be expanded upon later by human editors. Boghog (talk

) 07:29, 15 May 2011 (UTC)

So, apparently, the lists are useful in themselves too. So the optimal would perhaps be to have both prose and a list, the latter perhaps in a separate place in the {{

GNF_Protein_box}} template. At least, it should be encouraged to add practical details on the interactions where any such are known. Mikael Häggström (talk

) 11:46, 15 May 2011 (UTC)

Zoid and Zooid - need merging?

Hi, just came across this.. are these two articles about the same thing? Sorry I didn't know where else to ask, I'm not knowledgeable on this subject. -- œ^™ 16:59, 15 May 2011 (UTC)

I have no idea either but I'd say merge. The former seems to be a misspelt version and seems to be a name of a Pokemon. Plus, if it were a real Greek word, it would be ζά + εἶδος (very-like) or a clipped version of something with a zeta (ζ) before the declension suffix, such as trapezoid... --Squidonius (talk) 20:28, 15 May 2011 (UTC)

I'd hold off on a merger. These may need dab hat notes. Zooid (zoöid) /ˈzoʊ.ɔɪd/ and zoid (zoïd) /ˈzoʊ.ɪd/ are old synonyms, dating from the mid 19th century at the latest; it's quite possible that they have been formally distributed among the two meanings they were used for.

The broad historical usage is attested in the OED, which says of zooid:

Something that resembles an animal (but is not one in the strict or full sense): in early use applied somewhat widely, including, e.g., a free-moving animal or vegetable cell, as a spermatozoon or antherozooid; but chiefly restricted to an animal arising from another by asexual reproduction, i.e. budding (gemmation) or division (fission); spec. (and most usually) Each of the distinct beings or ‘persons’ which make up a compound or ‘colonial’ animal organism, and often have different forms and functions, thus more or less corresponding to the various organs in the higher animals.

It may well be that that early use has now been made specific to zoid.

BTW, there's also zoon /ˈzoʊ.ɒn/, pl. zoa, which is,

An organism scientifically regarded as a complete animal, i.e. one which is the total product of an impregnated ovum, whether constituting a single being as in the higher animals, or a number of distinct beings (zooids) as in the successive asexual generations of aphides or the various ‘persons’ that make up a compound or ‘colonial’ animal.

— kwami (talk) 00:17, 16 May 2011 (UTC)

Gene sharing

The article

Talk:Moonlighting protein. Quarl ^(talk

) 06:14, 17 April 2011 (UTC)

I work on (prokaryotic) enzyme promiscuity — different but still related to gene sharing—, but I have never heard the term Moonlighting protein, is it common? --Squidonius (talk) 07:19, 17 April 2011 (UTC)

I can't say I ever heard of it either. The "moonlighting" term has been used by more than one author (see PubMed). Gene sharing has also been used (see PubMed). Hence I am not sure which term would be preferred. Boghog (talk) 09:26, 17 April 2011 (UTC)

There are a lot more google hits for "gene sharing" than "moonlighting protein", but that reflects the ambiguous nature of the former phrase. I like the unambiguous nature of 'moonlighting protein'; 'gene sharing' requires explanation of what it isn't (horizontal gene transfer). The names also focus differently on the protein vs the gene. User:Kavrod wrote on Talk:Gene sharing in 2008 referencing "Times Literary Supplement, February 29 2008, p.30" in favor of moonlighting. Quarl ^(talk) 17:08, 17 April 2011 (UTC)

I've heard lecturers talk about proteins moonlighting, but hadn't realised it was a term used in scholarly literature. I concur with Quarl: "moonlighting protein" is much better than "gene sharing", because the latter is ambiguous—not only in principle, but also in practice, given that these three papers from this year alone use "gene sharing" to describe horizontal gene transfer. But my most preferred title is actually "protein moonlighting". That puts the emphasis on the underlying concept, in line with the current article. "Moonlighting protein" would be an appropriate title for an article that listed or discussed specific proteins that moonlighted, rather than one that treated the concept as an integrated whole. Adrian J. Hunter^{(talk•contribs)} 13:26, 18 April 2011 (UTC)

Re "protein moonlighting" to emphasize the concept: good idea. Quarl ^(talk) 14:05, 18 April 2011 (UTC)

 Done Since the educational class is over, I have gone ahead and merged

Moonlighting protein and renamed the later into Protein moonlighting. This article has also undergone a extensive peer review. While it needs some more work, especially after the merger, I think it is getting close to GA status. I will continue to work on this and would welcome additional input. Cheers. Boghog (talk

) 20:09, 21 May 2011 (UTC)

Wow, this article is now looking really good—nice work on the merge, Boghog! This is the kind of article I'd enjoy going over with a fine tooth-comb, if you wanted someone else to have a look before GA (FA?) submission, though real life will keep me too busy for the next 3–4 weeks. Adrian J. Hunter^{(talk•contribs)} 11:47, 22 May 2011 (UTC)

I feel like I've made this point before, but are there any sources that state gene-sharing and moonlighting protein are synonymous? Alternate splicing, for example, could produce two different proteins which could be said to share a gene. Also, gene sharing could apply to non-coding RNA; e.g. sense and antisense transcripts sharing a gene

^✰

12:31, 22 May 2011 (UTC)

The second paragraph of this review talks about both "gene sharing" and "moonlighting" and states that they are equivalent but the later term is preferred over the former. Boghog (talk) 15:01, 22 May 2011 (UTC)

Ah ok thanks, that dispels my concerns

^✰

15:48, 22 May 2011 (UTC)

External links to FactorBook

Someone has just pointed out a nice resource called FactorBook to me: http://zhome.umassmed.edu/elgg/ I suggested to the authors that they add links to their resource from the relevant Wikipedia articles. I already did one example for them at the IRF4 article. Does that sound reasonable? Alexbateman (talk) 07:24, 24 May 2011 (UTC)

Interesting site. I don't see any problem with linking to them, especially if they provide links back to Wikipedia. Also I think FactorBook needs to document better what kind of data is provided by their site. The "Enriched Motif" is apparently the consensus DNA binding site for that transcription factor. I have no idea what the "Aggregation Plot" is suppose to represent. Boghog (talk) 20:47, 24 May 2011 (UTC)

Merge proposal

There is a merge proposal at Talk:Α+β proteins that could do with some attention. Hans Adler 21:39, 25 May 2011 (UTC)

Reassessment requested

Hello all,

My circadian rhythms class has finished improving our selected circadian biology Wikipedia articles. We would appreciate if someone from the WikiProject could reassess the articles we've worked on (list

C1ock122 (talk

) 19:36, 26 May 2011 (UTC)

Acetyl-Coenzyme A acetyltransferase

I would appreciate some advice on the talk page of Acetyl-Coenzyme A acetyltransferase regarding some merges. Thanks. Cmcnicoll (talk) 23:01, 31 May 2011 (UTC)

WikiProject Computational BIology

We are currently trying to breath new life into

WikiProject Computational Biology. There is been quite a bit of overlap with this project and if there are any editors who are interested we could do with some help and advice in these early days. An important step currently is simply to identify Computational Biology articles and get them assessed so we can work out what needs working on. If you can spare a little time I'm sure we can give this project momentum enough to roll on its own. Thanks Alexbateman (talk

) 08:27, 9 June 2011 (UTC)

Requested move

Hi, there's currently a requested move underway at

Talk:SPINK5#Requested move which has been listed for a week and is yet to get any comments. I think the lack of comments is at least partially due to the technical aspect of the request (eg is it a protein or is it a gene? Hard for the lay person like myself to know). So, just wondering if any of this project's members who have any knowledge on the subject could add their thoughts to the requested move. Cheers, Jenks24 (talk

) 16:06, 22 June 2011 (UTC)

Replied at

Talk:SPINK5. Boghog (talk

) 04:24, 23 June 2011 (UTC)

International Space Station

In Space, solar winds, mostly charged particles such as protons, penetrate living tissue and damage DNA, apparently some simple forms of life can survive on the outside of the International Space Station. But I don't know much about this, and you can read the ISS article and still be confused about the topic, I could sure use some help with it. I put some stuff in about tetrigrades? I can't even spell them, small invertebrate anyhow. Anyone got a spare 5 minutes ? Penyulap _talk 15:12, 28 June 2011 (UTC)

I have nominated

featured article criteria. Articles are typically reviewed for two weeks. If substantial concerns are not addressed during the review period, the article will be moved to the Featured Article Removal Candidates list for a further period, where editors may declare "Keep" or "Delist" the article's featured status. The instructions for the review process are here

.

I suspect your "tetrigrades" are

Foton-M flights. A quick skim through isn't revealing a particular link to the ISS beyond a hope that experiments with tardigrades could be carried out there in the future. Did you have a particular reason for wanting to include them in the ISS article? It may be better to add a couple of lines to something like Outer space#Environment just above the section on the effects on the human body. Ka Faraq Gatri (talk

) 20:34, 28 June 2011 (UTC)

Template:Chemformula

{{Chemformula}} has been nominated for deletion. 65.94.47.63 (talk) 04:56, 30 June 2011 (UTC)

E. coli

I thought I might notify that I have gone ahead and split E.coli, which now comprises:

• the
  E. coli
  main page (general overview and description of the species)
• Pathogenic Escherichia coli (E.coli from the medical point of view)
• Escherichia coli (molecular biology)
  (E.coli from the scientists point of view)
• Escherichia coli (disambiguation) for all the strains which have pages

Any help is appreciated in fixing all issues resulting from copy-edits. Thanks --Squidonius (talk) 07:20, 17 July 2011 (UTC)

Links to FactorBook

Dear All,

I would like to add links to the FactorBook database which stores information about transcription factors particularly with respect to the ENCODE project. I have added a test link to IRF4, but have a list of a further 120 links that could be added. Here is the FactorBook pages for CTCF:

http://www.factorbook.org/mediawiki/index.php/CTCF

Do others feel it is appropriate to add these linkd to Wikipedia? Alexbateman (talk) 10:15, 1 August 2011 (UTC)

These links do look useful. In addition, it would be useful to internally document what FactorBook is either by adding a FaceBook section to the ENCODE or creating a new FactorBook article and including a wikilink with the external link. Boghog (talk) 11:06, 1 August 2011 (UTC)

To help with the documentation, I just created the {{FactorBook}} template where for example "{{FactorBook|IRF4}}" produces the link FactorBook IRF4. Boghog (talk) 11:18, 1 August 2011 (UTC)

Bacteriostatic agents

Hello! We currently have two articles,

Bacteriostat and Bacteriostatic agent, both apparently about the same subject, and neither of which have any supporting cites. I'd greatly appreciate it if someone knowledgeable could take a look at these, for fact-checking and possible merging. -- The Anome (talk

) 16:35, 3 August 2011 (UTC)

PyMOL needs to be updated

Dear MCB Project. It looks as though the PyMOL article still reflects a pre-Schrödinger version of said software. Does anyone here have the necessary familiarity with the Schrödinger version of PyMOL to update this article? It seems like there should be a way to do this while still preserving references to its open source development and the impact Warren DeLano had on the field. I(q) =

Talk(q)

01:40, 30 August 2011 (UTC)

Is there a better place for such a request? I(q) =

Talk(q)

16:21, 4 September 2011 (UTC)

Hi. This is probably as good a place as any. I have used both pre- and post-Schrödinger versions of PyMOL and they are qualitatively the same. The program has undergone continuous improvements (see for example list of new features). In addition, there are two parallel forks. The open source version that requires compiling and the paid version for which ready to run binaries and more complete documentation are supplied. Finally not surprisingly there is tighter integration between PyMOL and Maestro, the Schrödindger GUI for MacroModel and other Schrödinger software. Looking over the current version of the PyMOL, I don't see it as seriously out-of-date, but perhaps more detail could be added about the difference between the commercial and open source versions. Boghog (talk) 16:37, 4 September 2011 (UTC)

Ah, thanks. As I said I'm simply not familiar with the newer builds, thus am not really qualified to update the article myself. It's good to hear they haven't scrapped the basic functionality, and that an open source fork still exists. I(q) =

Talk(q)

18:05, 4 September 2011 (UTC)

Gene Wiki partnership with the journal Gene

Recently I've had some discussions with the editors at the journal Gene about how to encourage academics to improve Wikipedia articles on human genes. I started a discussion at the Village Pump. Please chime in there if you have any thoughts. Cheers,

talk

) 22:34, 9 September 2011 (UTC)

I commend your efforts here and hope that this occurs in many forums. In my view the not-so-hidden agenda of all these efforts is to further break down the barrier between the perceived value of pre vs post publication review and to highlight the value of living documents. In my area if, in the next few years, folks turn to Wikipedia for all their background reading in computational biology as opposed to expensive and inaccessible textbooks I will be very happy. --Pebourne (talk) 15:53, 10 September 2011 (UTC)

Proposed deletion of Capping enzyme complex

The article Capping enzyme complex has been proposed for deletion. The proposed-deletion notice added to the article should explain why.

While all contributions to Wikipedia are appreciated, content or articles may be

deleted for any of several reasons

.

You may prevent the proposed deletion by removing the {{proposed deletion/dated}} notice, but please explain why in your edit summary or on the article's talk page.

Please consider improving the article to address the issues raised. Removing {{proposed deletion/dated}} will stop the proposed deletion process, but other deletion processes exist. In particular, the speedy deletion process can result in deletion without discussion, and articles for deletion allows discussion to reach consensus for deletion. Sławomir Biały (talk) 20:20, 10 September 2011 (UTC)

PLoS Comp Biol Contributions

We would like to solicit your feedback on a proposal from PLoS Computational Biology (PCB). The journal proposes to help establish new Wikipedia pages in the field of computational biology that are not currently covered, either at all, or exist only as a stub. The pages would be created in the Wikipedia sandbox. When complete they would be reviewed by a newly appointed PCB Topic (aka Wiki) Pages Editor and folks s/he solicits, and if suitable the authors would be given the opportunity to publish it as a PCB Topic Page which would appear as part of the Education section of the journal. The page would be available from PLoS under a Creative Commons Attribution License. The PCB page would be indexed in PubMed and would provide a service to journal readers. As such it provides author incentive. PCB would only publish the Topic Page when it has been released into the public Wikipedia and the PCB page would become the copy of record. The community would make further enhancements to the Wikipedia page on an on-going basis as per usual.

The upside is that authors would be inclined to provide an initial starting point of high quality material as they get a PLoS publication and are indexed in PubMed. Wikipedia gains good content.

The downside is that if this became popular (more than 2-3 per month) PLoS would need to charge to recover publishing costs, but this would not be the case initially.

Phil Bourne EIC PLoS Computational Biology — Preceding unsigned comment added by Pebourne (talk • contribs) 14:30, 7 September 2011 (UTC)

This certainly sounds like a win-win proposal benefiting both PCB and Wikipedia. We first need to make sure that the Creative Commons Attribution License used by PLoS is compatible with

WP:TECHNICAL). Boghog (talk

) 16:47, 7 September 2011 (UTC)

Seems the Licenses are compatible. PCB is using CC BY 2.5 which is listed as compatible at

WP:COMPLIC. --Andreas (talk

) 16:55, 7 September 2011 (UTC)

Opps, sorry for not suggesting this earlier. Of course

COMPBIO talk page. Thanks for the suggestion Jebus989. Boghog (talk

) 18:02, 7 September 2011 (UTC)

This looks like a good opportunity, both for Wikipedia and for the potential authors. I would be happy to help review articles if this program becomes a reality. Antony–22 (talk⁄_contribs) 06:07, 8 September 2011 (UTC)

This is an exciting idea. What sort of granularity are you thinking? Will they be strictly computational biology related or would general biology articles qualify? It might be worth looking at a few MCB featured/good articles to see if any would fit your idea of an adequate PCB article. --Paul (talk) 10:47, 8 September 2011 (UTC)

I echo every one else's enthusiasm. (Struck by how coincidentally similar the set up is to the Gene Wiki partnership I mention in the next section.) If the articles will start on Wikipedia where anyone can contribute and edit, then I imagine authorship for the PCB article may be a sticky issue to deconvolute. You could use a system like

talk

) 22:41, 9 September 2011 (UTC)

Thank you for the positive feedback on the proposal, we are planning on proceeding based on this. As a point of clarification. The original authors of the Wikipedia page, which is developed in the sandbox, would be the authors of the PLoS CB Topic Page. The living version in Wikipedia would gain authors in the usual way, but they would not be authors of the copy of record in the journal. However, given the comments feature supported by al PLoS journals, Wikipedia page authors, or others, can add commentary to the journal copy of record should they wish too. At this point we are open to suggestions for computational biology topics and possible authors to be approached to begin the work. --Pebourne (talk) 15:39, 10 September 2011 (UTC)

I echo the broad support for this proposal, though

talk

) 23:49, 20 September 2011 (UTC)

Could someone please turn

Agreed - There is an article at Alanine scanning, but it's currently a two paragraph long stub so it could stand to be expanded. (+)H₃N-Protein\Chemist-CO₂(-) 17:00, 20 September 2011 (UTC)

Thanks for finding that! DMacks (talk) 17:40, 21 September 2011 (UTC)

Has there been any past discussion of creating a set of pages for the biosynthesis of each amino acid and cofactor? Each amino acid has a small section, but they vary enormously in style. methionine, for example, has one of the more detailed section, but it is really hard to read and describes how E. coli does it (only enterobacteria and yeast trans-sulfurylate, use succinyl and not acetyl and few organisms need/make cobaltamine (B12 for humans)). I would be willing to spend some time on this matter, but I think a universal layout style should be present to make it navigation-friendly. Maybe it could even have a template similar to {{cladogram}} for a metabolic map. Ecocyc/metacyc has a lot of info and would make work easier, so it is not an overly hard task: the problem would be consistency. --Squidonius (talk) 07:04, 21 September 2011 (UTC)

I not aware of any previous discussion about creating amino acid biosynthesis articles. It might be better to start working on the biosynthesis sections of the existing amino acid articles and then consider splitting out if these sections become very long. A possible alternative to cladogram templates is to incorporate WikiPathways stye templates (see Citric_acid_cycle#Interactive_pathway_map as example). The WikiPathways web site already contains a pathway for methionine biosynthesis (see "Find Methionine pathways". WikiPathways. {{cite web}}: Cite has empty unknown parameter: |coauthors= (help)). However sticking to the old-fashion schematics (see File:Tryptophan biosynthesis.png for example) still might be the best solution. Boghog (talk) 20:47, 21 September 2011 (UTC)

There is also this:

The Wikibook Principles of Biochemistry has a page on the topic of: Synthesis of aminoacids

Boghog (talk) 09:48, 25 September 2011 (UTC)

Thanks that is great: in that wikibook (collage of the wikipedia articles) the style changes for each amino acid and is excellent to see which works best (in my opinion lysine). --Squidonius (talk) 09:21, 27 September 2011 (UTC)

According to the ACS style guide (

Well, I'm going to go ahead and start making changes. Antony–22 (^talk⁄_contribs) 21:43, 4 October 2011 (UTC)

The citric acid cycle seems like a mature article, and knowledgeable editors seemed to have moved on, leaving a number of unanswered questions, as often happens. See "metabolism" above.

My question (there are others that may be more sophisticated) is that the article seems to say that all Krebs cycles are the same (identical) for all of the Animal Kingdom. That is a shocker. Including ants? Dust mites?

I read that "cats create their own Vitamin C." I know, "citric acid." But the writer was intending the information to be unique to cats and this article definitely makes no distinction except for plants. Is that correct? Thanks. Student7 (talk) 19:04, 26 October 2011 (UTC)

Basic metabolic pathways such the

WP:RD/S. Cheers. Boghog (talk

) 19:28, 26 October 2011 (UTC)

Thanks for the heads up. An impressive article for sure. I have added some project ratings, done some additional editing, and rolled out the welcome wagon. Cheers. Boghog (talk) 15:06, 20 November 2011 (UTC)

Immune system is an FA; it was suddenly rewritten, and this needs discussion here. Materialscientist (talk) 05:12, 8 December 2011 (UTC)

 Done Boghog (talk) 16:32, 5 January 2012 (UTC)

On the Talkpage:Pomegranate and the Talkpage:Cranberry a discussion is taking place pertaining to 1) the health effects of the aforementioned fruit and berry, and 2) whether the reviews could belong to the ‘further reading’ – section? I am hoping for a larger community input. Do you have time to take a look? Thank you.

Stated Low Prolactin Levels are associated with the precursor cells to oligodendrocytes that are responsible for creation of Myelin. Lesions in Myelin in time and place is Multiple Sclerosis (MS). There are too many associations with low prolactin levels and MS. Prolactin secretion levels are affected by pineal gland (the third eye sensing levels of light and regulation of circadian cycle. This corresponds to epidemiological data showing high levels of MS in the most northern latitudes, UK, Finland, etc.)at a youthful age in development. If the individual’s youthful development is in the lower latitude levels say South Africa and moves to say UK at the adult age, the individual takes his low risk with him. If the individual moves to the higher latitude locations at the youthful age, he adopts the high risk of MS of the high latitude location. This shows a link with the amount of sunlight availability and the endocrinological control system responsible for creating prolactin.

MS incidence appears to have some relation to post-pregnancy. Again prolactin at play.

My personal observation of dopamine surge activities lacking physical exertion such as gambling and drug use have some association with incidence of MS. It can be explained by the patho-mechanism of excess dopamine levels inhibiting prolactin secretions thereby having the low prolactin levels cause the dying off of the precursor cells to the oligodendrocytes and thereby causing MS.

Another relation between MS and prolactin is ACTH. ACTH secreted by anterior pituitary causes adrenal secretions of cortisol. Personal experience recalls use of ACTH to reverse remissions in MS? Prolactin is also released at the anterior pituitary.

More thought and research to the hormonal, humoral and neural control properties of prolactin may help in better understanding the patho-mechanism of MS.

166.250.44.189 (talk) 08:04, 11 January 2012 (UTC)

I refer the group to this thread on the Talk page at Major Depressive Disorder concerning the use of Vincent van Gogh's painting "At Eternity's Gate" in that article and to this comment of mine pointing out it has no place in the article and should be removed.

The essence of the complaint is that is fully documented that van Gogh's painting is not at all, nor was ever meant to be, a portrayal of depressive disorder but is rather merely a study of an old man. For that reason alone it should be removed for reasons of encyclopaedic accuracy.

As it stands it necessarily makes a judgement about the nature of depressive disorder, that it necessarily implies despair, even that it necessarily implies suicidal ideation (because of its title and van Gogh's own well known suicide). It is very much to be regretted indeed in my opinion that a Wikipedia administrator, Casliber, a practicising psychiatrist it seems but a poor historian of art, appears to be the prime mover behind perpetuating these poor judgements.

It also mythologises Vincent van Gogh himself who took the greatest care to separate his difficulties in life from his work; the nature of whose illness is not settled but which is not certainly typical of a depressive disorder; who is not documented as suffering from suicidal depressive moods in the last months of his life when this painting was completed and whose suicide itself has in the past year been plausibly questioned by a respected source as rather a manslaughter.

I ask that the image be removed. If it is felt necessary, and I cannot imagine why it should be, that the article be illustrated by a fine art image, then I suggest the original image, Durer's Melancholia, be reinserted. Skirtopodes (talk) 22:33, 13 January 2012 (UTC)

This is the wrong forum. If you have a disagreement about something, consider trying

dispute resolution. JFW | T@lk

23:51, 14 January 2012 (UTC)

A request for comment has been made at the above link. Your input is welcome. Boghog (talk) 20:55, 28 January 2012 (UTC)

Per Talk:Protein homology#discussion1. I'm inclined to agree regarding the need for a distinction, assuming this isn't already covered in another article. It also appears that we don't have an article that talks about structural homology at all really. Although we do seem to have an article on homology modeling, perhaps portions of that could be spun off into a putative structural homology (protein) article? (+)H₃N-Protein\Chemist-CO₂(-) 16:26, 6 February 2012 (UTC)

I'm running a WikiPedia/Wikimedia Commons workshop at the Biophysical Society in a couple of weeks, with expert help from User:Phoebe and sponsorship by the Education and the Early Careers committees of the society. We anticipate a large audience -- perhaps 50-75 working scientists who want to help edit articles and contribute media, and possibly involve their students also. I have truly enjoyed my own Wiki participation, and spreading this idea is one of things I'd like to accomplish as incoming president of the society.

We are thinking about starting a new WikiProject Biophysics as a subproject under Molecular and Cellular Bioogy to provide a collaborative workspace for them and future biophysicists, but would really appreciate feedback on the best way to proceed. Clearly the physics wikiproject is also suitably relevant; also a task force would be a possible alternative to a WikiProject. Thoughts? Would there be interest in this community in working on a dedicated biophysics project? Would it be sensible to have a subproject here and a task force under Physics (which could perhaps concentrate on topics, or aspects of an article, related to theory and to experimental techniques)? Dcrjsr (talk) 14:39, 12 February 2012 (UTC)

After various consultations, WikiProject Biophysics has now been started, under Biology -- it has a skeleton main page, and we will be recruiting new participants at next week's Biophysical Society meeting. Any interested Wikipedians would be extremely welcome!! Dcrjsr (talk) 18:35, 20 February 2012 (UTC)

So, there's a new project which may be of interest to some here. It arises out of Wikipedia:Village_pump_(proposals)#UID_interface_to_Wikipedia, a proposal to make wikipedia articles available by their UID - for instance by their UNIPROT number. Umm. And those two pages are all I have to show you, but I live in hope of input from you to take it all further. --Tagishsimon (talk) 20:48, 14 February 2012 (UTC)

Hello! As a new page patroller I have just come across the following articles, created by User:Rcrzarg on 10 February. They could use some attention and I am not even sure if they are suitable for inclusion here, so I thought I would give you guys a heads up and see if you had any advice on how to handle them :). They are:

• Small non-coding RNAs in the endosymbiotic diazotroph α-proteobacterium Sinorhizobium meliloti
• Αr7 RNA
• Αr9 RNA
• Αr14 RNA
• Αr15 RNA
• Αr35 RNA
• Αr45 RNA

Thanks! --Cerebellum (talk) 16:32, 21 February 2012 (UTC)

I am about to embark on improvements to articles relating to circadian clocks, with a particular interest in improving content related to plant circadian clocks. So far I have edited the lede for

There's a bit of confusion on Commons about the graphs to the right. They say that they show two different genes, and are used in two different articles. However the files themselves are identical. Would 2 different, but related, genes show up identically on this sort of graph? If so - do we need different graphs for each of the genes in question?--Nilfanion (talk) 09:08, 3 March 2012 (UTC)

A stub was recently created for

Thanks for the alert, I would have never noticed otherwise. Left my comment over at

talk

) 03:50, 26 March 2012 (UTC)

Left a message there Flowright138 (talk) (contributions) 03:05, 30 March 2012 (UTC)

I just posted a major update to Circular permutation in proteins. The page is currently listed a stub. Would someone please evaluate the new article for quality and importance?

I wouldn't normally ask directly, but the update is the first wikipedia article published in collaboration with PLoS as part of their new Topic Page track. As such it will likely receive a significant amount of attention from blogs and the press.

--Quantum7 23:14, 29 March 2012 (UTC)

 Done A rating of B sounds good to me, and I based it off of the grading criteria of course. Someone else can certainly change that if I've been too generous or something, but I think its fair.

talk

) 00:07, 30 March 2012 (UTC)

Thanks, Jesse. We'll try to make some improvements and get it up to at least an A. --Quantum7 17:47, 30 March 2012 (UTC)

Should this page (

 Done – Thanks for the heads up. These two articles are obviously about the same gene/protein. Therefore I have been

WP:BOLD and completed the merger. Boghog (talk

) 03:40, 2 April 2012 (UTC)

If anyone is still active here (no more Tim Vickers?), two new articles were created on this today-- I proposed merger to the main article after cleanup. See Talk:Apoptosis#Merger proposal. SandyGeorgia (Talk) 15:08, 3 April 2012 (UTC)

I'm here, and I see from the other sections just above that there are a few others. I support the merge.

talk

) 15:18, 3 April 2012 (UTC)

Hey everyone, I've been heavily editing

I've taken care of several of the diseases, and I'm trying to figure out the rest. There's a checklist on the Talk page. Advice/comments on them and the rest of the article would be greatly appreciated, now more than ever. I feel that GA nominations are very close! Please let me know what you think or if there are issues that need to be addressed.

talk

) 19:23, 17 March 2012 (UTC)

Its now a GA nominee. I'd appreciate it if someone could review it. :D

Hi all, I am trying to get the support to set up a WikiProject for immunology. My reasons are stated at the proposal page, a discussion has also be initiated. Currently, I am just trying to get a feel of how many editors are interested, and whether we have enough to build a task group for a one-month drive, or to improve on one major article, to see how feasible it is to have a WikiProject. Any input, whether opposing or supporting, would be very much appreciated. Again, the link to the proposal is here. Many thanks. Kinkreet^{~♥moshi moshi♥~} 13:22, 5 April 2012 (UTC)

Wikipedia:HighBeam describes a limited opportunity for Wikipedia editors to have access to HighBeam Research.
—Wavelength (talk) 15:51, 5 April 2012 (UTC)

This is a notice to let you know about