Haplogroup I-M170
This article needs attention from an expert in Human Genetic History. The specific problem is: Nomenclature of haplogroup(s) and subclades.(January 2016) |
The article's lead section may need to be rewritten. (January 2023) |
Haplogroup I-M170 | |
---|---|
Possible time of origin | ~42,900 Years BP [2] |
Coalescence age | ~27,500 Years BP [3] |
Possible place of origin | I2 |
Defining mutations | L41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, U179 |
Haplogroup I (M170) is a
Haplogroup I appears to have arisen in Europe, so far being found in Palaeolithic sites throughout Europe (Fu 2016), but not outside it. It diverged from common ancestor IJ* about 43,000 years B.P. (Karafet 2008). Early evidence for haplogroup J has been found in the Caucasus and Iran (Jones 2015, Fu 2016). In addition, living examples of the precursor Haplogroup IJ* have been found only in Iran, among the
Haplogroup I has been found in multiple individuals belonging to the Gravettian culture. The Gravettians expanded westwards from the far corner of Eastern Europe, likely Russia, to Central Europe. They are associated with a genetic cluster that is normally called the Věstonice cluster.[2][3][4]
Origins
Available evidence suggests that I-M170 was preceded into areas in which it would later become dominant by haplogroups
Haplogroup IJ was in the Middle East and/or Europe about 40,000 years ago.[citation needed] The TMRCA (time to most recent common ancestor) for I-M170 was estimated by Karafet and colleagues in 2008 to be 22,200 years ago, with a confidence interval between 15,300 and 30,000 years ago.[9] This would make the founding event of I-M170 approximately contemporaneous with the Last Glacial Maximum (LGM), which lasted from 26,500 years ago until approximately 19,500 years ago.[10] TMRCA is an estimate of the time of subclade divergence. Rootsi and colleagues in 2004 also note two other dates for a clade, age of STR variation, and time since population divergence. These last two dates are roughly associated, and occur somewhat after subclade divergence. For Haplogroup I-M170 they estimate time to STR variation as 24,000 ±7,100 years ago and time to population divergence as 23,000 ±7,700 years ago.[11] These estimates are consistent with those of Karafet 2008 cited above. However, Underhill and his colleagues calculate the time to subclade divergence of I1 and I2 to be 28,400 ±5,100 years ago, although they calculate the STR variation age of I1 at only 8,100 ±1,500 years ago.[12]
Semino (2000) speculated that the initial dispersion of this population corresponds to the diffusion of the
The five known cases of Haplogroup I from
Due to the arrival of so-called
The earliest documentation of
In one instance, haplogroup I was found far from Europe, among 2,000-year-old remains from Mongolia.[17]
It would seem to be that separate waves of population movement impacted
The existence of Haplogroup IJK – the ancestor of both haplogroups IJ and K (M9) – and its evolutionary distance from other subclades of Haplogroup F (M89), supports the inference that haplogroups IJ and K both arose in Southwestern Asia. Living carriers of F* and IJ* have been reported from the Iranian Plateau.[1]
Distribution
Frequencies of Haplogroup I:
Population | % hg I | % hg I (Subpopulation) | Sampled individuals | Source |
Abazinians |
3.4 | 88 | Sergeevich 2007[18] | |
Abkhazians | 33.3 | 12 | Nasidze Ivan 2004[19] | |
Adyghe (Adygea) | 7 | 154 | [20] | |
Cherkessia ) |
2 | 126 | Sergeevich 2007[18] | |
Adyghe (Kabardia) | 10 | 59 | Nasidze Ivan 2004[19] | |
Afghanistan | 3 ( Hazara people )
|
60 | El Sibai 2009[21] | |
Afghanistan | 1.5% | 3.3% (2/60) Hazara, 1.8% (1/56) Tajik
|
204 | Haber et al. 2012[22] |
Afghanistan | 0.99% | 2.6% (2/77) | 507 | Di Cristofaro 2013[23] |
Albanians | 13% (29/223) (Albania) | 223 | Sarno 2015 | |
Albanians | 16 ( Gheg )
|
Ferri 2010 | ||
Albanians | 21.82% (12/55) (Tirana) | 55 | Battaglia 2008 | |
Albanians | 7 (Tirana) | 30 | Bosch 2006 | |
Algerians | 0 | 156 | [24] | |
Andis | 27 | |||
Armenians | 5 | FTDNA 2013[25] | ||
Avars | 2 | 115 | Balanovsky | |
Austrians | 28 | 50 ( Tyrol )
|
[26] | |
Ashkenazi |
1 | 1099 | [27] | |
Azeri | 3 | 72 | Nasidze Ivan 2004 | |
Balkars | 3 | 135 | Kutuev 2007[28] | |
Belarusians | 23 | 11 (West), 15 (North), 16 (East), 28 (Centre), 30 (East Polesie ), 34 (West Polesie)
|
565 | Kushniarevich 2013 |
Belarusians | 32 | Polesie - 43 (Vichin), 12 (Avtyuki)
|
204 | Sergeevich 2015[29] |
Bosnia and Herzegovina | 53 | 73 (Croats), 49 (Bosniaks), 33 (Serbs) | 256 | Marjanovic 2006 |
Bosnia and Herzegovina | 65 | Herzegovina- 71 ( Siroki Brijeg), Bosnia- 54 (Zenica )
|
210 | Pericic 2005[30] |
Bosnia and Herzegovina | 73 (Croats), 45 (Bosniaks), 36 (Serbs) | 255 | Battaglia 2008[31] | |
Bulgarians | 27-29 | 40 (Varna), 32 (Sofia), 30 (Plovdiv), 10 (Haskovo) | 935 | Karachanak 2009–13[32][33] |
Bulgarians | 34 | 100 | Begona Martinez-Cruz 2012 | |
Bulgaria | 19 (Bulgarian Turks) | 63 | Zaharova 2002[34] | |
Central Asia | 2 | 984 | Rootsi 2004 | |
Chechens | 0 | 330 | Balanovsky | |
Croats | 45 | 1100 | Mrsic 2012 | |
Croats | 47 | 55 (Hvar), 52 (Osijek), 41 (Pula), 57 (Split), 29 (Varaždin) | 518 | Primorac 2022[35] |
Cyprus | 1 | 164 | El-Sibai 2009[36] | |
Czechs | 18 | 25 (Klatovy), 25 (Písek), 15 (Brno) 14 (Hradec Králové), 10 (Třebíč) | 257 | Luca 2007[37] |
Danes | 49 | 194 | Rootsi 2004 | |
Darginians |
58 | 26 | Nasidze Ivan 2004 | |
Darginians (Kaitak) |
0 | 101 | ||
Dutch | 27.8 | 2085 | Altena 2020[38] | |
Dutch | 33 | 410 | Van Doorn 2008[39] | |
Egyptians | 0 | 124 | El-Sibai 2009[40] | |
Egyptians | 1 | 370 | [24] | |
Estonians | 19 | 194 | Rootsi 2004 | |
English | 18 | 945 | Rootsi 2004 | |
English | 26 | 12 (Cornwall), 38 (Essex) | 1830 | FTDNA 2016[41] |
Estonians | 17 | 118 | Lappalainen 2008[42] | |
Flemish Belgians | 28 | 113 | [43] | |
Finland | 29 | 36 (Swedes from Ostrobothnia), 15 ( Northern Savo )
|
536 | Lappalainen 2006[44] |
French | 16 (South), 24 (Normandy), 4 (Lyon), 4 (Corsica) | Rootsi 2004 | ||
French | 9 | 5 ( Nord Pas de Calais )
|
555 | Ramos-Luis 2009[45] |
French | 13 | 11 (Paris), 18 (Strasburg), 10 (Lyon) | 333 | Kari Hauhio[26] |
Gagauzes |
28 | 89 | Varzari 2006 | |
Georgians | 0 | 63 | Rootsi 2004 | |
Georgians | 4 | 77 | Nasidze Ivan 2004 | |
Germans | 24 | 32 (Berlin), 32 (Hamburg), 15 (Leipzig) | 1215 | Kayser 2005[46] |
Greeks | 14 | 30 (Macedonia) | 261 | Rootsi 2004 |
Greeks | 10 (Athens), 30 (Macedonia) | 149 | Battaglia 2008 | |
Greeks | 36 () | 366 | Di Giacommo 2003[47] | |
Greeks | 12 (North), 24 (South) | 142 | Zalloua 2008 | |
Greenlanders |
17 | 215 | Sanchez 2004[48] | |
Hungarians | 23 | 162 | Rootsi 2004 | |
Hungarians | 28 | 230 | Vago Zalan Andrea 2008 | |
Indians | 0 (North India) | 560 | [49] | |
Ingush | 0 | 143 | ||
Iranians | 2 | 22 (South Iran), 5 ( Teheran )
|
186 | Di Cristofaro 2013[23] |
Iranians | 1 (West), 1 (East) | 324 | [50] | |
Iranians | 0 | 83 | Rootsi 2004 | |
Iranians | 1 | 92 | El-Sibai 2009[36] | |
Iranians | 0 | 6 ( Khorasan, Yazd )
|
952 | Grugni 2012 |
Iraqis | 1 | 176 | Rootsi 2004[51] | |
Iraqis | 1 | 117 | El-Sibai 2009[36] | |
Irish | 11 | 76 | Rootsi 2004 | |
Irish | 10 | 119 | Cappeli 2013[52] | |
Irish | 11 (Rush, Dublin) | Capelli 2003 | ||
Italians | 5 (North), 7 (Central), 9 (South and Sicily), 39 (Sardinia) | Rootsi 2004 | ||
Italians | 10 | 31 (Sardinia), 4 (Umbria, Marche) | 884 | Boattini 2013[53] |
Italians | 7 | 0 () | 524 | Di Giacomo 2003[54] |
Italians | 36 (Filettino) 35 (Cappadocia, Abruzzo), 28 (Vallepietra) | Messina 2015[55] | ||
Italians | 23 ( Latini )
|
583 | Brisighelli 2012[56] | |
Italians | 30 (Stelvio) | [57] | ||
Italians | 31 (Caccamo) | Gaetano 2008[58] | ||
Jordanians |
1 | 273 | El-Sibai 2009[36] | |
Jordanians |
5 (Amman), 0 (Dead Sea) | 146 | Flores 2005[59] | |
Kara Nogays |
13 | 76 | ||
Karachays | 9 | 69 | Sergeevich 2007[18] | |
Kazakhs | 1 | 370 | [60] | |
Kosovar Albanians |
8 | 114 | Pericic 2005 | |
Kumyks | 0 | 73 | Kutuev 2007[28] | |
Kurds | 4 (West Iran) | 21 | Malyarchuk 2013[61] | |
Kurds | 2 (Iran) | 59 | Gragni 2012 | |
Kurmanji | 17 (Turkey), 0 (Georgia) | 112 | Nasidze 2005[62] | |
Kuwaiti | 0 | 42 | El-Sibai 2009[36] | |
Kyrgyzstan | 0 (Uyghurs), 0 (Kyrgyz) | Di Cristofaro 2013[23] | ||
Laks |
14 | [63] | ||
Latvians | 9 | 3 (Southwest) | [64] | |
Lebanese | 3 | 10 (North Shia )
|
951 | [36][65] |
Lebanese | 5 | 66 | Rootsi 2004 | |
Lezgis |
0 | 81 | ||
Lithuanians | 7 | Kushniarevich 2015 | ||
Libyans |
0 | 83 | [24] | |
Libyans |
2 | 1 | 175 | Fendri 2015[66] |
Macedonians | 34 (Skopje) | 79 | Pericic 2005 | |
Macedonians | 24 | 31 (Macedonians), 12 (Albanians) | 343 | Noevski 2010 |
Macedonians | 13 (Albanians) | 64 | Battaglia 2008[31] | |
Maltese | 12 | 90 | El-Sibai 2009[36] | |
Moldovans | 29 (Moldovans), 25 (Ukrainians) | Varzari 2006 | ||
Moroccans | 0 | 316 | El-Sibai 2009[36] | |
Moroccans | 0 | 760 | [24] | |
Mongols | 1 | 160 | Di Cristofaro 2013[23] | |
Norwegians | 37 | 40 (Oslo) 30 (West), 42 (East, South), 35 (North), 33 (Bergen) | Dupuy 2005 | |
Pakistan | 0 | 638 | [67] | |
Poles | 17 | 19 (Warsaw), 12 (Lublin), 22 (Szczecin) | 913 | Kayser 2005 |
Poles | 18 | 191 | Rootsi 2004 | |
Portuguese | 5 | 303 | Rootsi 2004 | |
Portuguese | 8 | 3 ( Setubal), 18 (Braga )
|
657 | Beleza 2005[68] |
Qatar | 0 | 72 | El-Sibai 2009[36] | |
Romani | 17 (Hungary), 10 ( Tiszavasvari), 5 (Tokaj ) 37 (Taktakoz), 11 (Slovakia)
|
Vago Zalan Andrea 2008 | ||
Romanians | 28 | 36 ( Cluj )
|
178 | Martinez-Cruz 2012[69] |
Romanians | 22 | 361 | Rootsi 2004 | |
Russians | 13 (North Europe), 18 (Centre Europe), 21 (South Europe), 27 (Unzha), 0 (Mezen) | 1228 | Balanovsky 2008 | |
Russia | 2 () | Rootsi 2004 | ||
Saami |
31 | Rootsi 2004 | ||
Saudis |
0 | 1597 | [70] | |
Scotland | 11 | 17 ( Scottish Isles )
|
Rootsi 2004 | |
Sephardi |
4 (Portugal) | 57 | ||
Serbs | 39 | Serbia with Kosovo | 209 | Zgonjanin 209[71] |
Serbs | 48 (Serbia), 39 (Kosovo), 52 (Herzegovina and Montenegro) | 1200 | Mihajlovic 2022[72] | |
Slovaks | 28 | 250 | Petrejcikova 2013[73] | |
Slovenians |
30 | 57 ( Spodnjeposavska )
|
458 | Vakar 2010[74] |
Spaniards | 6 | 18 (Asturias), 0 (Gascony) | 1002 | Adams 2008[75] |
Sudanese | 5 (Nubians), 4 (Gaalien), 7 (Mesereia) | [76] | ||
Swedes | 42 | 32 (Ostergotaland & Jonkoping) 50 ( Varmland )
|
305 | Karlsson2006[77] |
Swedes | 26 (North Sweden),[78] | Rootsi2004 | ||
Swedes | 41 (South), 26 (North) | Rootsi 2004 | ||
Swedes | 44 | 60 (), 52 (South Norrland) | 1800 | FTDNA 2016[79] |
Swiss | 8 | 144 | Rootsi 2004 | |
Swiss | 23 | 13 (Lausanne), 32 (Bern) | [26] | |
Syrians | 2 (West), 3 (East) | 520 | [50] | |
Syrians | 2 | 554 | El Sibai 2009[36] | |
Tataers | 33 (China) | 33 | [80] | |
Tunisians | 0 | El-Sibai 2009[36] | ||
Tunisians | 0 | 601 | [24] | |
Turks | 5 | 12 ( Eastern Anatolia )
|
523 | Cinnioglu 2003 |
Turks | 5 | 741 | Rootsi 2004 | |
UAE |
0 | 164 | El-Sibai 2009[36] | |
Ukrainians | 22 | 585 | Rootsi 2004 | |
Ukrainians | 28 | 33 (Sumy), 23 (Ivano-Frankivsk) | 701 | Kushniarevich 2013 |
Welsh | 8 | 196 | Rootsi 2004 | |
Yemenese | 0 | 62 | El-Sibai 2009[36] | |
Zazas | 33 (Turkey) | 27 | Nasidze 2005[62] | |
17 ( Constanta), 39 (Romanians in Piteşti)
|
Bosch 2006[81] | |||
47 ( Kongaz ), 25 (Ukrainians from Rashkovo)
|
Vazari 2006 | |||
38 () | Lappalainen2008[82] | |||
34 () | Nasidze Ivan. 2004[19] | |||
3 (Tajiks) 3 (East Persians) | Malyarchuk 2013[61] | |||
2 ( Tuvinians )
|
Subgroups
The subclades of Haplogroup I-M170 with their defining mutations, as of 2011.[83] Up-to-date phylogenetic trees listing all currently known subclades of I can be found at Y-Full and FamilyTreeDNA
- I-M170 ( L41, M170, M258, P19_1, P19_2, P19_3, P19_4, P19_5, P38, P212, Page123, U179) Middle East, Caucasus, Europe.
-
- I1a DF29/S438
- I1a1 CTS6364/Z2336
- I1a1a M227
- I1a1a1 M72
- I1a1b L22/S142
- I1a1b1 P109
- I1a1b2 L205
- I1a1b3 L287
- I1a1b3a L258/S335
- I1a1b3a1 L296
- I1a1b3a L258/S335
- I1a1b4 L300/S241
- I1a1b5 L813/Z719
- I1a1a M227
- I1a2 S244/Z58
- I1a2a S246/Z59
- I1a2a1 S337/Z60, S439/Z61, Z62
- I1a2a1a Z140, Z141
- I1a2a1a1 Z2535
- I1a2a1a1a L338
- I1a2a1a2 F2642
- I1a2a1a1 Z2535
- I1a2a1b Z73
- I1a2a1c L573
- I1a2a1d L1248
- I1a2a1d1 L803
- I1a2a1a Z140, Z141
- I1a2a2 Z382
- I1a2a1 S337/Z60, S439/Z61, Z62
- I1a2b S296/Z138, Z139
- I1a2b1 Z2541
- I1a2a S246/Z59
- I1a3 S243/Z63
- I1a3a L1237
- I1a1 CTS6364/Z2336
- I1b Z131[85]
- I1a DF29/S438
- I-M438 Haplogroup I2 L68/PF3781/S329, M438/P215/PF3853/S31
- I2a L460/PF3647/S238
- I2a1 P37.2
- I2a1a L158/PF4073/S433, L159.1/S169.1, M26/PF4056
- I2a1a1 L160/PF4013
- I2a1b L178/S328, M423
- I2a1b1 L161.1/S185
- I2a1b2 L621/S392
- I2a1b2a1a L147.2
- I2a1c L233/S183
- I2a1a L158/PF4073/S433, L159.1/S169.1, M26/PF4056
- I2a2 L35/PF3862/S150, L37/PF6900/S153, L181, M436/P214/PF3856/S33, P216/PF3855/S30, P217/PF3854/S23, P218/S32
- I2a2a L34/PF3857/S151, L36/S152, L59, L368, L622, M223, P219/PF3859/S24, P220/S119, P221/PF3858/S120, P222/PF3861/U250/S118, P223/PF3860/S117, Z77
- I2a2a1 CTS616, CTS9183
- I2a2a1a M284
- I2a2a1a1 L1195
- I2a2a1a1a L126/S165, L137/S166, L369
- I2a2a1a1b L1193
- I2a2a1a1 L1195
- I2a2a1b L701, L702
- I2a2a1b1 P78
- I2a2a1b2 L699, L703
- I2a2a1b2a L704
- I2a2a1c Z161
- I2a2a1c1 L801/S390
- I2a2a1c1a CTS1977
- I2a2a1c1a1 P95
- I2a2a1c1b CTS6433
- I2a2a1c1b1 Z78
- I2a2a1c1b1a L1198
- I2a2a1c1b1a1 Z190
- I2a2a1c1b1a1a S434/Z79
- I2a2a1c1b1a1 Z190
- I2a2a1c1b1a L1198
- I2a2a1c1b1 Z78
- I2a2a1c1a CTS1977
- I2a2a1c2 L623, L147.4
- I2a2a1c1 L801/S390
- I2a2a1d L1229
- I2a2a1d1 Z2054
- I2a2a1d1a L812/S391
- I2a2a1d2 L1230
- I2a2a1d1 Z2054
- I2a2a1a M284
- I2a2a2 L1228
- I2a2a1 CTS616, CTS9183
- I2a2b L38/S154, L39/S155, L40/S156, L65.1/S159.1, L272.3
- I2a2b1 L533
- I2a2a L34/PF3857/S151, L36/S152, L59, L368, L622, M223, P219/PF3859/S24, P220/S119, P221/PF3858/S120, P222/PF3861/U250/S118, P223/PF3860/S117, Z77
- I2a1 P37.2
- I2b L415, L416, L417
- I2c L596/PF6907/S292, L597/S333
- I2a L460/PF3647/S238
-
Note that the naming of some of the subgroups has changed, as new markers have been identified, and the sequence of mutations has become clearer.
I-M170
The composite subclade I-M170 contains individuals directly descended from the earliest members of Haplogroup I, bearing none of the subsequent mutations which identify the remaining named subclades.
Several I* individuals, who do not fall into any known subclades, have been found among the
There are also high frequencies of Haplogroup I* among the
(Neither study from which the above figures were drawn excluded the present I2-M438 clade as a whole, but only certain subclades, so these presumed cases I* may possibly belong to I2.)
A living
I1-M253
Haplogroup I1-M253 (M253, M307, P30, P40) displays a very clear frequency gradient, with a peak frequency of approximately 35% among the populations of southern Norway, southwestern Sweden, and Denmark, and rapidly decreasing frequencies toward the edges of the historically Germanic-influenced world. A notable exception is Finland, where frequency in West Finns is up to 40%, and in certain provinces like Satakunta more than 50%. I1 is believed to have become common as a result of a founder effect during the Nordic Bronze Age, and subsequently spread throughout Europe during the Migration Period when Germanic tribes migrated from southern Scandinavia and northern Germany to other places in Europe.[89]
Outside
I2-M438
Haplogroup I2-M438, previously I1b, may have originated in southern Europe – it is now found at its highest frequencies in the western Balkans and Sardinia – some 15,000–17,000 years ago and developed into three main subgroups : I2-M438*, I2a-L460, I2b-L415 and I2c-L596.
I2a1a-M26
Haplogroup I2a1a-M26 is notable for its strong presence in Sardinia. Haplogroup I-M170 comprises approximately 40% of all patrilines among the
Haplogroup I2a1a-M26 is practically absent east of France and Italy,
The distribution of I2a1a-M26 also mirrors that of the Atlantic Bronze Age cultures, which indicates a potential spread via the obsidian trade or a regular maritime exchange of some of metallurgical products.[92]
I2a1b-M423
Haplogroup I2a1b-M423 is the most frequent Y-chromosome haplogroup I-M170 in Central and Eastern European populations, reaching its peak in the
I2a2-M436
The distribution of Haplogroup I2a2-M436 (M436/P214/S33, P216/S30, P217/S23, P218/S32) is closely correlated to that of Haplogroup I1 except in Fennoscandia, which suggests that it was probably harbored by at least one of the Paleolithic refuge populations that also harbored Haplogroup I1-M253; the lack of correlation between the distributions of I1-M253 and I2a2-M436 in Fennoscandia may be a result of Haplogroup I2a2-M436's being more strongly affected in the earliest settlement of this region by founder effects and genetic drift due to its rarity, as Haplogroup I2a2-M436 comprises less than 10% of the total Y-chromosome diversity of all populations outside of Lower Saxony. Haplogroup I2a2-M436 has been found in over 4% of the population only in Germany, the Netherlands, Belgium, Denmark, England (not including Cornwall), Scotland, and the southern tips of Sweden and Norway in Northwest Europe; the provinces of Normandy, Maine, Anjou, and Perche in northwestern France; the province of Provence in southeastern France; the regions of Tuscany, Umbria, and Latium in Italy; and Moldavia and the area around Russia's Ryazan Oblast and Republic of Mordovia in Eastern Europe. One subclade of Haplogroup I2a2-M436, namely I2a2a1a1-M284, has been found almost exclusively among the population of Great Britain, which has been taken to suggest that the clade may have a very long history in that island. It is notable, however, that the distributions of Haplogroup I1-M253 and Haplogroup I2a2-M436 seem to correlate fairly well with the extent of historical influence of Germanic peoples. The punctual presence of both haplogroups at a low frequency in the area of the historical regions of Bithynia and Galatia in Turkey may be related to the Varangian Guard or rather suggests a connection with the ancient Gauls of Thrace, several tribes of which are recorded to have immigrated to those parts of Anatolia at the invitation of Nicomedes I of Bithynia. This suggestion is supported by recent genetic studies regarding Y-DNA Haplogroup I2b2-L38 have concluded that there was some Late Iron Age migration of Celtic La Tène people, through Belgium, to the British Isles including north-east Ireland.[95]
Haplogroup I2a2-M436 also occurs among approximately 1% of
Specifications of mutation
The technical details of U179 are:
- Nucleotide change (rs2319818): G to A
- Position (base pair): 275
- Total size (base pairs): 220
- Forward 5′→ 3′: aaggggatatgacgactgatt
- Reverse 5′→ 3′: cagctcctcttttcaactctca
Height
This haplogroup reaches its maximum frequency in the Western Balkans (with the highest concentration of I2 in present-day
See also
- Haplogroup
- Human Y-chromosome DNA haplogroups
- Haplogroup I1 (Y-DNA)
- Haplogroup I2 (Y-DNA)
- Late Glacial Maximum
- Aurignacian
- Proto-Indo-Europeans
- Gravettian
Notes
- Barać L, Pericić M, Klarić IM, et al. (July 2003). "Y chromosomal heritage of Croatian population and its island isolates" (PDF). Eur. J. Hum. Genet. 11 (7): 535–42. S2CID 15822710.
- Bennett, E.A., Prat, S., Péan, S., Crépin, L., Yanevich, A., Puaud, S., ... & Geigl, E. M. (2019). The origin of the Gravettians: genomic evidence from a 36,000-year-old Eastern European. BioRxiv, 685404.
- Rootsi, S, Kivisild, T, Benuzzi, G, Help, H, et al. (2019). "Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in Europe". Am. J. Hum. Genet. 75 (1): 128–137. S2CID 2834639.
- The Genographic Project, National Geographic, Atlas of the Human Journey
- ISOGG, Y-DNA Haplogroup I and its Subclades
References
- ^ PMID 22815981.
- ^ "Publications Detail View". fgga.univie.ac.at. Retrieved 2020-12-15.
- PMID 33318530.
- S2CID 198249005.
- PMID 27135931.
- ^ Seguin-Orlando et al. (2014)「Genomic structure in Europeans dating back at least 36,200 years」
- PMID 33159107.
- ^ "Y-SNP calls for Krems WA3". Genetiker. 2016-05-11. Retrieved 2020-12-15.
- PMID 18385274.
- S2CID 1324559.
- ^ PMID 15162323.
- ^ P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.), Rethinking the Human Evolution (2007), pp. 33–42.
- PMID 11073453.
- ^ a b "Palaeolithic DNA from Eurasia". Archived from the original on 2016-10-03. Retrieved 5 October 2016.
- PMID 27135931.
- ^ "Ancient DNA reveals 'genetic continuity' between Stone Age and modern populations in East Asia". February 2017.
- ]
- ^ a b c ИЗУЧЕНИЕ ГЕНЕТИЧЕСКОЙ СТРУКТУРЫ НАРОДОВ ЗАПАДНОГО КАВКАЗА ПО ДАННЫМ О ПОЛИМОРФИЗМЕ Y-ХРОМОСОМЫ, МИТОХОНДРИАЛЬНОЙ ДНК И ALU-ИНСЕРЦИЙ
- ^ S2CID 27204150. Archived from the original(PDF) on 2017-01-18. Retrieved 2016-10-09.
- ^ Yunusbayev 2011
- PMID 22470552.
- PMID 22470552.
- ^ a b c d Afghan Hindu Kush: Where Eurasian Sub-Continent Gene Flows Converge
- ^ a b c d e Introducing the Algerian Mitochondrial DNA and Y-Chromosome Profiles into the North African Landscape
- ^ "Armenian DNA Project". Archived from the original on 2016-10-11. Retrieved 2016-10-08.
- ^ a b c "Where did European men come from?" (PDF). www.jogg.info. 2008. Retrieved 2019-06-07.
- ^ "Comments on 2014 Klyosov Article on Jewish DNA Genealogy p. 1 of 2 - Levite DNA". Archived from the original on 2016-11-12. Retrieved 2016-10-09.
- ^ a b Кутуев Ильдус Альбертович. Генетическая структура и молекулярная филогеография народов кавказа
- ^ ВКЛАД ОТДЕЛЬНЫХ ПОЛЕССКИХ ПОПУЛЯЦИЙ И ПОПУЛЯЦИИ БЕЛОРУССКИХ ТАТАР В ГЕНОФОНД НАСЕЛЕНИЯ БЕЛАРУСИ [1]
- ^ PMID 15944443.
- ^ PMID 19107149.
- .
- PMID 23483890.
- ^ "Bulgarian_Y_Table.xlsx".
- PMID 35722696.
- ^ a b c d e f g h i j k l m Geographical Structure of the Y-chromosomal Genetic Landscape of the Levant: A coastal-inland contrast
- ^ Y-chromosomal variation in the Czech Republic
- ^ Altena, E., Smeding, R., van der Gaag, K.J. et al. The Dutch Y-chromosomal landscape. Eur J Hum Genet 28, 287–299 (2020). https://doi.org/10.1038/s41431-019-0496-0
- ^ ZONEN VAN ADAM IN NEDERLAND Genetische genealogie : een zoektocht in ons DNA-archief
- PMID 19686289.
- ^ "Photo" (PNG). s-media-cache-ak0.pinimg.com. Retrieved 2019-06-07.
- ^ Migration Eaves to the Baltic Region
- ^ "Y Haplogroup Frequencies in the Flemish Populstion".
- PMID 16644145.
- S2CID 85134429.
- S2CID 11066186.
- ^ "Archived copy" (PDF). Archived from the original (PDF) on 2017-01-20. Retrieved 2016-10-08.
{{cite web}}
: CS1 maint: archived copy as title (link)(subscription required) - .
- ^ Presence of three different paternal lineages among North Indians: a study of 560 Y chromosomes (2009)
- ^ a b Influences of history, geography, and religion on genetic structure: the Maronites in Lebanon
- PMID 15024688.
- ^ A Y Chromosome Census of the British Isles
- ^ Uniparental Markers in Italy Reveal a Sex-Biased Genetic Structure and Different Historical Strata
- ^ Clinal patterns of human Y chromosomal diversity in continental Italy and Greece are dominated by drift and founder effects
- ^ Traces of forgotten historical events in mountain communities in Central Italy: A genetic insight
- ^ Uniparental Markers of Contemporary Italian Population Reveals Details on Its Pre-Roman Heritage
- ^ Genetic Structure in Contemporary South Tyrolean Isolated Populations Revealed by Analysis of Y-Chromosome, mtDNA, and Alu Polymorphisms
- ^ Differential Greek and northern African migrations to Sicily are supported by genetic evidence from the Y chromosome
- ^ Isolates in a corridor of migrations: A high-resolution analysis of Y-chromosome variation in Jordan
- ^ Вестник Московского университета. Серия XXIII АНТРОПОЛОГИЯ № 1/2014: 96–101СВЯЗЬ ИЗМЕНЧИВОСТИ Y ХРОМОСОМЫ И РОДОВОЙСТРУКТУРЫ: ГЕНОФОНД СТЕПНОЙ АРИСТОКРАТИИИ ДУХОВЕНСТВА КАЗАХОВ
- ^ a b Y chromosomes in Iranians and Tajiks
- ^ a b MtDNA and Y-chromosome Variation in Kurdish Groups
- ^ The dual origin of tati-speakers from dagestan as written in the genealogy of uniparental variants
- ^ Pliss et al. Y-Chromosomal Lineages of Latvians in the Contextof the Genetic Variation of the Eastern-Baltic Region
- ^ Y-Chromosomal Diversity in Lebanon Is Structured by Recent Historical Events
- ^ Paternal lineages in Libya inferred from Y-chromosome haplogroups
- ^ Y-chromosomal evidence for a limited Greek contribution to the Pathan population of Pakistan (2006)
- ^ Micro-Phylogeographic and Demographic History of Portuguese Male Lineages
- PMID 22848614.
- ^ Saudi Arabian Y-Chromosome diversity and its relationship with nearby regions.
- PMID 28789900.
- S2CID 251658864.
- ^ The genetic structure of the Slovak population revealed by Y-chromosome polymorphisms
- ^ ANALIZA Y-DNK HAPLOTIPOV SLOVENCEV
- ^ Adams et al. The Genetic Legacy of Religious Diversity and Intolerance: Paternal Lineages of Christians, Jews, and Muslims in the Iberian Peninsula
- ^ Y-Chromosome Variation Among Sudanese: Restricted Gene Flow, Concordance With Language, Geography, and History
- PMID 16724001.
- PMID 15162323.
- ^ "Swedish Haplogroup Database (Stats haplopie)". Archived from the original on 2016-10-10. Retrieved 2016-10-08.
- ^ Y-chromosome distributions among populations in Northwest China identify significant contribution from Central Asian pastoralists and lesser influence of western Eurasians (2010)
- S2CID 23156886.
- S2CID 32079904.
- ^ ISOGG 2011
- S2CID 10763736.
- ^ "ISOGG 2017 Y-DNA Haplogroup I". isogg.org.
- ^ PMID 19911015.
- PMID 15162323.
- PMID 24204668.
- S2CID 4399103.
- PMID 19781941.
- PMID 16724001.
- ^ a b c Rootsi; et al. "Phylogeography of Y-Chromosome Haplogroup I Reveals Distinct Domains of Prehistoric Gene Flow in Europe figure 1" (PDF). Archived from the original (PDF) on 2007-03-03.
- ]
- ^ O.M. Utevska (2017). Генофонд українців за різними системами генетичних маркерів: походження і місце на європейському генетичному просторі [The gene pool of Ukrainians revealed by different systems of genetic markers: the origin and statement in Europe] (PhD) (in Ukrainian). National Research Center for Radiation Medicine of National Academy of Sciences of Ukraine. pp. 219–226, 302.
- ISBN 978-1-84217-410-4.
- PMID 22470552.
- PMID 28484621.
- PMID 25190282.
External links
Phylogenetic tree and distribution maps
- Y-DNA Haplogroup I-M170 and Its Subclades from the International Society of Genetic Genealogy (ISOGG)of 2013
- Phylogeography of Y-Chromosome Haplogroup I
- Frequency Distributions of Y-DNA Haplogroup I and its subclades – with Video Tutorial
- Frequency and Variance of I1b (now considered I2a2-M26)
- Map of 'I1a' (now considered I-M253)
- Map of 'I1b' (now considered I2a-P37.2)
- Map of 'I1c' (now considered I2b-M223)
- Rescalled Haplogroup I Tree (K. Nordtvedt 2011).
Projects
- I Project at FTDNA
- I1 Project at FTDNA
- I2* Project at FTDNA
- I2a project at FTDNA
- I2b project at FTDNA
- I2b2 L38+ project at FTDNA
- The Scandinavian yDNA Genealogical Project at FTDNA
- The Finland Genealogical Project at FTDNA
Other
- Study of Y-Haplogroup I and Modal Haplotypes
- The Y Chromosome Consortium (YCC)
- Example haplotypes from I1* "y cluster"
- YCC Haplogroup I page – I1a (now considered I-M253), I1b (now considered I-P37.2) and I1c (now considered I-M223)
- Haplo-I Subclade Predictor
- Spread of Haplogroup I, from National Geographic
- I2b2 Y-DNA found in Bronze Age skeletons of Lichtenstein Cave
- Haplogroup I-L38 (I2b2) In Search of the Origin of I-L38 (aka I2b2)